ZFIN ID: ZDB-TSCRIPT-141209-298
Transcript Name: mknk1-201
Previous Name: mknk1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050323 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050323|OTTDARG00000035371|ZDB-GENE-080220-11 mknk1|OTTDARP00000039499 mknk1-002 LG_ CR847923.9 Danio rerio protein_coding KNOWN, 524 bp
CGGCTGCAGTTTACAGCTCGCTCCACTCCTTCAGGCGCTC
CACTGCTCCTGCCAGATATCCAGTAGCATTCTGGGATCGG
GTAAGGTGGAGAGCCGTGGTTCGCTCTCTCGTGTCCCCAG
TACCGTCTCGCAAACCTCTACAGGATTAGGAATGGAGAGC
AGTCAACCAATCAGCATCACAGACCCAAGTTCACGCCGAA
AGAAGAAACGCAGAAGAGCCGGAGACAGTTTCACAGGCAA
ATTTTGTGATCTATACAGGCTGACGGATGAGCTGCTGGGT
CAGGGAGCTTATGCCAAAGTCCAGGGCTGTGTGAGTTTAC
AAAATGGCACGGAGTATGCGGTAAAGATAATCGAGAAGAA
TGCTGGTCACAGTCGCAGCCGAGTTTTTAGAGAGGTGGAG
ACGCTTTACCAGTGTCAAGGAAACAAGAACATTCTGGAGC
TGATTCAGTTTTTTGAAGATGACAGCTGCTTTTATCTGGT
GTTTGAGAAGTTACGTGGAGGTTCCATTTTGACACACATC
CAGA

mknk1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mknk1-201 524
mknk1-202 (1)    Ensembl 2665
ncRNA mknk1-003 (1)    Ensembl 789
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mknk1-201 Contained in:
[BAC] DKEY-231N3 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000050323 (1),  Ensembl_Trans:ENSDART00000123257 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB765296 (1) 527 nt
GenBank:AL926703 (1) 279 nt
CITATIONS (2)