ZFIN ID: ZDB-TSCRIPT-141209-3232
Transcript Name: mknk1-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060868 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060868|OTTDARG00000035371|ZDB-GENE-080220-11 mknk1|no_translation mknk1-003 LG_ CR847923.9 Danio rerio protein_coding KNOWN, 789 bp
CAAGGGCAACTAAACGCAAAATAATGATTAGTAGTTTATA
TTATACAAACTAAATGTAACCATTTGGTGTTTGCTTTAAA
TATAATCATATTTATTTGTTTTCCAGAATGCACCTGAAAG
AGTTCTTCCAACTCCTCGTGTTCTACAAAGAAACTGCAGC
ACTAAAGATCTGACGCAGTTTGCAGCTGAAGCCATCGCGT
TTAACCGGCAGCTGTCGCAACAGGAAGAAGAGCAGGAAGA
CTTTGGCGCTGTCGTCTGCTCCATGAGGCTTTCTCCGCCT
TCTAACTCTAGACTTGCCCGTCGTCGAGCACAGTCTCAAG
CACTACGCAACAATACCTGAAGTCAACCCGCTGCACAGGT
GCATTATAACCGTTCAGACACTTCAGAAACACACAAATGC
GCATGCACCAGGTACTACCAGACTAACCTTATGTGTACTA
AACCATGCACACGTCTTTAATTCATTTCGCAGGTCTGCTT
GGTCGTCTTTCTGTTCACCTATTGTGGGTTTGGTATCAGA
ATGTTTATAATTATCGTCATATATTTATGGCTGGTGGTGA
TTGTTAGTCAGATATAAAAAAGTGCTCGGCTATGTGGGAG
GGAATAGACCATTTTATTTTAATGTAACGATGACATTCGC
ATCGCTTTTAAATGTAAGTTAGCGTTTCTATTCTTAAAAC
AAGTTTTATTATTTTTAAAAACCACTTTAGTTACTGTGAA
GCACTGGACCTCTTGCTCTGTCACTTTTTTTACTTTTATT
TTTTTACAATATTTAAGCAGTTGTAAGTA

mknk1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA mknk1-003 789
mRNA mknk1-201 (1) 524
mknk1-202 (1) 2665
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mknk1-003 Contained in:
OTHER mknk1-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000060868 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DN895234 (1) 784bp
    GenBank:EB863705 (1) 480bp
    CITATIONS (1)