header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-2738
Transcript Name: mknk1-202
Previous Name: mknk1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050322 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050322|OTTDARG00000035371|ZDB-GENE-080220-11 mknk1|OTTDARP00000039498 mknk1-001 LG_ CR847923.9 Danio rerio protein_coding KNOWN, 2665 bp
CGGTTGGCGCGTTTGGGGGTGGTGCTGTTGTGTTTCTGTG
TTGTCCCCCCTCCACCTCTTCCTCCTCCTCACTGCTGCTG
TTCAGCGGAGGATGGCGGAGGCAGTCCCTGTCCAGCGAGA
CTCATTCGGCTGCAGTTTACAGCTCGCTCCACTCCTTCAG
GCGCTCCACTGCTCCTGCCAGATATCCAGTAGCATTCTGG
GATCGGGTAAGGTGGAGAGCCGTGGTTCGCTCTCTCGTGT
CCCCAGTACCGTCTCGCAAACCTCTACAGGAATGGAGAGC
AGTCAACCAATCAGCATCACAGACCCAAGTTCACGCCGAA
AGAAGAAACGCAGAAGAGCCGGAGACAGTTTCACAGGCAA
ATTTTGTGATCTATACAGGCTGACGGATGAGCTGCTGGGT
CAGGGAGCTTATGCCAAAGTCCAGGGCTGTGTGAGTTTAC
AAAATGGCACGGAGTATGCGGTAAAGATAATCGAGAAGAA
TGCTGGTCACAGTCGCAGCCGAGTTTTTAGAGAGGTGGAG
ACGCTTTACCAGTGTCAAGGAAACAAGAACATTCTGGAGC
TGATTCAGTTTTTTGAAGATGACAGCTGCTTTTATCTGGT
GTTTGAGAAGTTACGTGGAGGTTCCATTTTGACACACATC
CAGAGTCGAAAATACTTCGACGAGAGAGAAGCGAGTCGTG
TGGTCAGGGATATAGCAAATGCACTAGACTTTCTGCACAA
CAAAGGAATCGCCCACCGTGATCTTAAGCCTGAAAATATC
CTCTGTGAATATACTGATAAGGTTTCCCCTGTGAAGATCT
GTGATTTTGATCTTGGCAGTGGAGTAAAGCTGAACAGTGC
CTGTACCCCAATTACCACCCCTGAGCTCACCACACCGTGT
GGCTCAGCAGAGTACATGGCTCCTGAGGTGGTGGAGGTCT
TCACGGACGAAGCTTCATTCTATGATAAGCGATGTGACCT
CTGGAGCCTCGGGGTCATTCTCTACATCCTGCTTAGCGGG
AGTCCGCCATTTACTGGCCATTGTGGCACCAACTGTGGCT
GGGAACGAGGAGAAACATGTCGTTCCTGCCAGAATAATCT
GTTTGAGAGGATTCAGGAGGGAAAGTATGAGTTCAGCGAT
GGAGTCTGGACACAGATATCAGCTGATGCCAAAGATCTGA
TCTCGCGGCTACTGGTGCGAGATGCCACTTTACGGCTAAG
TGCCGCTCAGGTCCTGCAGCATCCCTGGGTGCAGGGGAAT
GCACCTGAAAGAGTTCTTCCAACTCCTCGTGTTCTACAAA
GAAACTGCAGCACTAAAGATCTGACGCAGTTTGCAGCTGA
AGCCATCGCGTTTAACCGGCAGCTGTCGCAACAGGAAGAA
GAGCAGGAAGACTTTGGCGCTGTCGTCTGCTCCATGAGGC
TTTCTCCGCCTTCTAACTCTAGACTTGCCCGTCGTCGAGC
ACAGTCTCAAGCACTACGCAACAATACCTGAAGTCAACCC
GCTGCACAGGTGCATTATAACCGTTCAGACACTTCAGAAA
CACACAAATGCGCATGCACCAGGTACTACCAGACTAACCT
TATGTGTACTAAACCATGCACACGTCTTTAATTCATTTCG
CAGGTCTGCTTGGTCGTCTTTCTGTTCACCTATTGTGGGT
TTGGTATCAGAATGTTTATAATTATCGTCATATATTTATG
GCTGGTGGTGATTGTTAGTCAGATATAAAAAAGTGCTCGG
CTATGTGGGAGGGAATAGACCATTTTATTTTAATGTAACG
ATGACATTCGCATCGCTTTTAAATGTAAGTTAGCGTTTCT
ATTCTTAAAACAAGTTTTATTATTTTTAAAAACCACTTTA
GTTACTGTGAAGCACTGGACCTCTTGCTCTGTCACTTTTT
TTACTTTTATTTTTTTACAATATTTAAGCAGTTGTAAGTA
TTAAATAATTTTTTGCTTTATTTTCGCTATGTACTGTAAA
GCCATGCTGCCTGACAGTAACATACCATAGAATTGCGTAT
TATTATGAGAGGTACGATGAGGTATTATAGATATTTGACT
TGTTACTTTTTAGCTTAAACTGTATTTATTGCATAGTATA
TTTTTGTCATTTCAGATGATTATATATTTCTTTTAATGTA
TTTTTTTTGCATTATTTTCTTGTCAATGTGAAGTATTTTT
TTATGCATGAGGGCAAAGAACATATTCGGTAATGAGATAG
ATTAAGTTTTAATTTTTTGATTTGCATTCAGTGGAAATTG
TGCCATTTTCAGGCTTGGGGGCAGAGCTCCTGATGTGCAA
AATAACTAAATTACCTCTCAAAATTGCCTTTTGTATTATC
AAATCGAGTTATTTTTCCTGTTATTTGTTGCAGATTGAGC
TGAGATGAAATGGTAAGAATTTAGTGATTGTCCATGTATT
ATTTATTTCTGTACCTTCATGAGAATTTGTTAGTATACAT
TTCTTGTACCAGGGATGACACTAGAGGGCGCTACCTCATA
TTAATGCCCATGTTCTCAGCACTCAGCCAGTATGATACTG
ATGGAGTATCTCAGTCTACGTTCAGGAATGGTGTAAATTG
AATGGCCATTTAACCCCTAATAAACTCTGGGACAGATTGT
GGGGCAGGGGTGTTCATTTGGTTTTCCAATTTTGAGAAAT
AAAGCAATTTGCACTGAACCAAGAA

mknk1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA mknk1-003 (1) 789
mRNA mknk1-201 (1) 524
mknk1-202 2665
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mknk1-202 Contained in:
OTHER mknk1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050322 (1)
  • Ensembl_Trans:ENSDART00000125371 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC154477 (1) 2579bp
    GenBank:EG580031 (1) 636bp
    CITATIONS (2)