Transcript

pus3-004

ID
ZDB-TSCRIPT-131113-882
Name
pus3-004
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056113 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056113|OTTDARG00000032022|ZDB-GENE-030131-9433 pus3|no_translation pus3-004 LG_ FP089511.13 Danio rerio protein_coding KNOWN, 650 bp
GTATGAGGGAACGCATGACTTCAGGAACCTCTGTAAGATG
GATGTCGGTAATGGAGTCCTGCAGTTTCAGAGGACCATCT
TGTCTGCCAGTGTCCAGCCAGCACAACTCCCACACCCCAG
CGTCCACAATGACCCGCACCAGCTCTTTGTCTTCCAGGTC
AAAGGTCTTGCTTTCCTCTATCACCAGGTCCGCTGCATGA
TGGCATTGCTGCTGCTTATCGGACAGAAACTGGAAGCTCC
TGAAGTCATTGATCAACTGCTGGATGTGGAGAAAAACCCA
AGGAAACCTCAGTACAGCATGGCGGTGGACTATCCTCTGG
TCTTGTACGATTGCCACTTTGAGGGTGTGAACTGGAGGAA
TGAAACCGAGGAGGAAATCCACATCCTGAACACGTTTCAC
CAACACTGGGTCCAGAATGCAGTGAAAACCCAAATTCTGC
TCGGGATGATCCAGGGCCTTCAAAACACAAGCACAGGTGT
GTGTTTCAGAGCTTAAAAAACCAATGAACTCCCAACACAC
ACTGGCTGCTGTTCATGCTCTAAAGGGACAGTTCACCCCA
AAATTTTAATTCTGCCATCATTTACTCGATCTTCACTTGT
TTAAGTTCCTTTCTTCTGTTGAACACAAATAAAGATATTT
TGAAGAAAGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations