Transcript

pus3-005

ID
ZDB-TSCRIPT-131113-2475
Name
pus3-005
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056114 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056114|OTTDARG00000032022|ZDB-GENE-030131-9433 pus3|no_translation pus3-005 LG_ FP089511.13 Danio rerio protein_coding KNOWN, 854 bp
CCCACCACTGCTTTTCCAGGTCCGCTGCATGATGGCATTG
CTGCTGCTTATCGGACAGAAACTGGAAGCTCCTGAAGTCA
TTGATCAACTGCTGGATGTGGAGAAAAACCCAAGGAAACC
TCAGTACAGGTGGGGGTTATTTTTGATTCAAAAGTGAATT
CTGAAGACTTTTTAGTTGAAATTTTTTAACCCTTTAACTC
TCCCACCAAGAAAAAATGTTTTTATTGCATTTCTCCTAAT
GTCGCTAGTTAACACACTCAATGCATTTTTTTTCCCAACA
CATCCCATGATTTCTAAAATATTAACCCCTACCTAATAGT
TGATATATCGATTTATCCAACCATCCAGTAGGTCTCATCT
AAAAACAGTCAGTGAGATCTGACAAGGCTTTAGGAAATGT
AGTATTCATGAGCGCATGTGTTTTACAGCATGGCGGTGGA
CTATCCTCTGGTCTTGTACGATTGCCACTTTGAGGGTGTG
AACTGGAGGAATGAAACCGAGGAGGAAATCCACATCCTGA
ACACGTTTCACCAACACTGGGTCCAGAATGCAGTGAAAAC
CCAAATTCTGCTCGGGATGATCCAGGGCCTTCAAAACACA
AGCACAGAGATGGGGTCTCTGCAGTGCTGGCTCATGGAAG
GGTCCCGGCAAAAAAAATACCAACCTCTTTTGAGTCGGCC
ACGCTGTGAGAGTCTGGAGTCCAGGATTCAGCACTTTGTG
AAGAGAGGACGACTGGAGCAAGAAGAAGGAGAGAATGGAG
AGGAGACCACTGTTTTCAGGGGGAAAAGATCCAAACATGC
TCATCTGACAACAACAAACCAAATACAGAACAAAAACAGT
GAAGCAGAAACAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations