Transcript

pus3-201

ID
ZDB-TSCRIPT-091110-553
Name
pus3-201
Previous Names
  • pus3-001
  • ch211-253b1.7-001
  • dkey-25o1.4-001
  • ottdart00000044652
  • si:ch211-253b1.7-001
  • zfinnucl0000002950
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044652 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044652|OTTDARG00000032022|ZDB-GENE-030131-9433 pus3|OTTDARP00000035328 pus3-001 LG_ FP089511.13 Danio rerio protein_coding KNOWN, 1860 bp
ATTTGAGTAAATCAGTCACATCACTGATTTATTTAGCGAA
CGTGTGTCACTTTTAAACGGGACTTTTATTCTGACGTGTG
GCTTTACGGAAGCCTGAAGCCAGTGTACCATGGTGTGCGG
CGTTTAAAAGTTACTGTTCAGGATTTGTGCTTTAGCTCTT
TTCGTGAAGCTTCTGAACGGACGAGTTTGCTGGGATGTCA
TCAGAAGTGCTGCGGGTTCGAGTGAAGGCTCTGGAGGAGG
AGCTGGAGAGACTGAAAGCTCAGCTGAGAGCAGAGACGGA
GGAGAAATCTCAAACGCCTGAGAGCGGGTCCAGACAGAAG
AAACAAAGAGTGGAAAAACCCTTCGACTTCTCCGCTCACC
CGCGCAGACACGTGGCTCTGCGTCTGGCATATCTGGGCTG
GCAGTACCAGGGCTTCGCTGTGCAGGAAAACACTGATAAT
ACTGTTGAAGCGCGGCTGTTCGAGGCTCTGCTGAAGACCA
AACTGATCCAGGACAGACAGACGTCCTGCTATCACCGCTG
CGGACGCACTGATAAAGGAGTCAGCGCTTTCTCTCAGGTT
ATATCAATCGACCTGCGCTCCACCCAGTATGGAGGCGGTT
TAGGTGTGACTGTTCCAGCTGATGTTGATGTCAAAGGCAA
GACTTCGGCAGATGAGCTACCTTATGTGAAGATCCTCAAC
CGAGTCCTGCCTCAGGACATCCGAATCCTGCAATGGGCCC
CTGTAGAGAGCGGATTCAGCGCACGATTTGACTGCCAGTC
CCGGACATACAGATACTACTTTCCCCGAGGAGATCTGGAT
TTGGAGCTCATGGCAGAGGCTGCAAAACGGTATGAGGGAA
CGCATGACTTCAGGAACCTCTGTAAGATGGATGTCGGTAA
TGGAGTCCTGCAGTTTCAGAGGACCATCTTGTCTGCCAGT
GTCCAGCCAGCACAACTCCCACACCCCAGCGTCCACAATG
ACCCGCACCAGCTCTTTGTCTTCCAGGTCAAAGGTCTTGC
TTTCCTCTATCACCAGGTCCGCTGCATGATGGCATTGCTG
CTGCTTATCGGACAGAAACTGGAAGCTCCTGAAGTCATTG
ATCAACTGCTGGATGTGGAGAAAAACCCAAGGAAACCTCA
GTACAGCATGGCGGTGGACTATCCTCTGGTCTTGTACGAT
TGCCACTTTGAGGGTGTGAACTGGAGGAATGAAACCGAGG
AGGAAATCCACATCCTGAACACGTTTCACCAACACTGGGT
CCAGAATGCAGTGAAAACCCAAATTCTGCTCGGGATGATC
CAGGGCCTTCAAAACACAAGCACAGAGATGGGGTCTCTGC
AGTGCTGGCTCATGGAAGGGTCCCGGCAAAAAAAATACCA
ACCTCTTTTGAGTCGGCCACGCTGTGAGAGTCTGGAGTCC
AGGATTCAGCACTTTGTGAAGAGAGGACGACTGGAGCAAG
AAGAAGGAGAGAATGGAGAGGAGACCACTGTTTTCAGGGG
GAAAAGATCCAAACATGCTCATCTGACAACAACAAACCAA
ATACAGAACAAAAACAGTGAAGCAGAAACAGAGGAAAGTT
CTTTACAAAACCTGTAAATCTTCTGTCTTCTGCTGTCGGT
TTTACTCTGTTTGATTTGAAGGTAAAACAGAGACTTTGTT
TTGTGTTTTCTTTTCTTCACAGCAGAATTACCTCATGCTC
TGCAGAAATAATCTCTTTTAATAAAGGAGTTTTCCACGTA
TTTTAATGAAAGTATTGTTTGTGTAGAATAGGTTGAATTT
GGAAATGACCACCTACTGTATTTTATTTACTAAAGTTGCT
GACCTTTGGGGCGATTATACGGCCCCTATTTATTAACTAA
AAACCTTCTTTATGCCTTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations