ZFIN ID: ZDB-TSCRIPT-131113-3318
Transcript Name: fxyd6l-204
Previous Names: fxyd6l-005, dkey-56f14.6-005

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048553 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048553|OTTDARG00000034333|ZDB-GENE-071205-8 fxyd6l|OTTDARP00000038106 DKEY-56F14.6-005 LG_ CR848666.4 Danio rerio protein_coding PUTATIVE, 396 bp
CGGGCGCGCGTTCGAACATCACTAATCATAGTTGTGGTCA
TGACACCACACGTATAATTATTTACAGTCAGCTCACGGTT
TACAGAATAGATCTTTTAAAACTCATACAAGAAGATTTTT
TCCATTTCATTCTATAGAAATTTGCAGAAAGTGTCGTCAA
AAGATTGCCCGAGGGATTTTTTGTCTGGATCAACAAGCTG
ACAAGATGGAACTTTGTGTTGCTGCAGCGCTTTTGTCCTT
CTTCACTCCAGCTTTGGCCTCCAAAATGGATGAGATTCAT
GATTATGAATCTCTGAGGATCGGTGGTATGGTCTTTGCCG
TGATCCTCTTCCTGATGGGGATCTTCCTTATTGTCAGCCG
GAAATGCCGCTGCAAAGGGAACAAGTCAAAGTAAGT

fxyd6l TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA fxyd6l-201 (1)    Ensembl 320
fxyd6l-202 (1)    Ensembl 813
fxyd6l-203 (1)    Ensembl 376
fxyd6l-204 396
fxyd6l-205 (1)    Ensembl 998
fxyd6l-206 (1)    Ensembl 360
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fxyd6l-204 Contained in:
[BAC] DKEY-56F14 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000048553 (1),  Ensembl_Trans:ENSDART00000155614 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH446230 (1) 818 nt
CITATIONS (2)