Transcript

fxyd6l-204

ID
ZDB-TSCRIPT-131113-3318
Name
fxyd6l-204
Previous Names
  • fxyd6l-005
  • dkey-56f14.6-005
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048553 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048553|OTTDARG00000034333|ZDB-GENE-071205-8 fxyd6l|OTTDARP00000038106 DKEY-56F14.6-005 LG_ CR848666.4 Danio rerio protein_coding PUTATIVE, 396 bp
CGGGCGCGCGTTCGAACATCACTAATCATAGTTGTGGTCA
TGACACCACACGTATAATTATTTACAGTCAGCTCACGGTT
TACAGAATAGATCTTTTAAAACTCATACAAGAAGATTTTT
TCCATTTCATTCTATAGAAATTTGCAGAAAGTGTCGTCAA
AAGATTGCCCGAGGGATTTTTTGTCTGGATCAACAAGCTG
ACAAGATGGAACTTTGTGTTGCTGCAGCGCTTTTGTCCTT
CTTCACTCCAGCTTTGGCCTCCAAAATGGATGAGATTCAT
GATTATGAATCTCTGAGGATCGGTGGTATGGTCTTTGCCG
TGATCCTCTTCCTGATGGGGATCTTCCTTATTGTCAGCCG
GAAATGCCGCTGCAAAGGGAACAAGTCAAAGTAAGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations