ZFIN ID: ZDB-TSCRIPT-131113-125
Transcript Name: fxyd6l-202
Previous Names: dkey-56f14.6-002, fxyd6l-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048551 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048551|OTTDARG00000034333|ZDB-GENE-071205-8 fxyd6l|OTTDARP00000038080 DKEY-56F14.6-002 LG_ CR848666.4 Danio rerio protein_coding PUTATIVE, 813 bp
GTGCTTTTACGTTGTTTTGAAGATGAGGAGGTTTTGCTGG
TTATCAAGCTGGGATGAAAAACCTGGACATTTTTTTTCTA
TAAAATAACTTGTATGCTTTATGTTTGGATCCACAACACC
TGACAAGATGGAACTTTGTGTTGCTGCAGCGCTTTTGTCC
TTCTTCACTCCAGCTTTGGCCTCCAAAATGGATGAGATTC
ATGAGTCAGACAAGCCATTTCATTATGATTATGAATCTCT
GAGGATCGGTGGTATGGTCTTTGCCGTGATCCTCTTCCTG
ATGGGGATCTTCCTTATTGTCAGCCGGAAATGCCGCTGCA
AAGGGAACAAGTCAAAGCCAGTTGGAATTGACGCAGAGGC
AGCCAGAGGTGCAAAATGAAGTAACCCGAGGGAACAAATC
CAGAAAACATGGCTTTTTAAGAAGAAATTTTACAACTTTG
ACCGTTTGGAAGAAGAAAAGGTCATGAGGATTTAGTTTTT
CTTTAGTGTTTATCACAATTTTTACCTTTTTATGGCAGTA
TTTCTTTATCTTTTGGGTACATGAATATGATTAAAAAAAT
GTGATTCTCAGCTAGAACTACTTTGCCATAATGTTTAATT
CAGCAGCTGATACTTGAGATTTTTCCTCAACTTTCTGTCA
TGTACTTTTAGGCTCTCCGTGTAATTGAAGTTTGTAGTAG
AGTAAGTGCTTAGTAGCCAACAGAAAACAGTTGTTGTTTT
ATATATTTTGTAAATTGTTCACCCAGTTTTGTCACTTTGC
AAAAGTAACAATTCACGCTGTACACAGTAGGAAATAAAGT
GATTTCTATGGAA

fxyd6l TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA fxyd6l-201 (1) 320
fxyd6l-202 813
fxyd6l-203 (1) 376
fxyd6l-204 (1) 396
fxyd6l-205 (1) 998
fxyd6l-206 (1) 360
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fxyd6l-202 Contained in:
OTHER fxyd6l-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048551 (1)
  • Ensembl_Trans:ENSDART00000154319 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC150369 (1) 830bp
    CITATIONS (2)