ZFIN ID: ZDB-TSCRIPT-131113-1720
Transcript Name: fxyd6l-203
Previous Names: fxyd6l-006, dkey-56f14.6-006

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048552 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048552|OTTDARG00000034333|ZDB-GENE-071205-8 fxyd6l|OTTDARP00000038105 DKEY-56F14.6-006 LG_ CR848666.4 Danio rerio protein_coding PUTATIVE, 376 bp
ACACGGGCGCGCGTTCGAACATCACTAATCATAGTTGTGG
TCATGACACCACACGTATAATTATTTACAGTCAGCTCACG
GTTTACAGAATAGATCTTTTAAAACTCATACAAGAAGATT
TTTTCCATTTCATTCTATAGAAATTTGCAGAAAGTGTCGT
CAAAAGATTGCCCGAGGGATTTTTTGTCTGGATCAACAAG
CTGACAAGATGGAACTTTGTGTTGCTGCAGCGCTTTTGTC
CTTCTTCACTCCAGCTTTGGCCTCCAAAATGGATGAGATT
CATGAGTCAGACAAGCCATTTCATTATGGCCGGAAATGCC
GCTGCAAAGGGAACAAGTCAAAGCCAGTTGGAATTGACGC
AGAGGCAGCCAGAGGT

fxyd6l TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA fxyd6l-201 (1)    Ensembl 320
fxyd6l-202 (1)    Ensembl 813
fxyd6l-203 376
fxyd6l-204 (1)    Ensembl 396
fxyd6l-205 (1)    Ensembl 998
fxyd6l-206 (1)    Ensembl 360
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fxyd6l-203 Contained in:
[BAC] DKEY-56F14 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000048552 (1),  Ensembl_Trans:ENSDART00000154787 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK696189 (1) 380 nt
CITATIONS (2)