ZFIN ID: ZDB-TSCRIPT-120702-51
Transcript Name: hectd1-206
Previous Name: hectd1-005

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055566 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055566|OTTDARG00000020482|ZDB-GENE-030616-153 hectd1|OTTDARP00000043581 hectd1-005 LG_none BX465838.15,BX324186.12 Danio rerio protein_coding KNOWN, 566 bp
CCAGCGGACAAACACACTACCTCTCCCTGTCTGGTCTAGA
GATCTATGGCACTGTTACTGGTGTGTGTGAGGATCAGCTG
GGTAAAGCAGTGAAAGAGGCAGAGGCCAACCTGAGACGGC
AGCGGCGACTCTTTCGCTCGCAGGTGATGAAGTACATTGT
TCCAGGAGCGCGGGTGGTGCGAGGCATTGACTGGAAGTGG
CGAGACCAGGATGGCAATCCTGCTGGAGAAGGCACTGTGA
CTGGAGAAGCCCACAATGGCACACCGCAGTCCTGGAGCAG
CCTGGTGAAAAATAACTGTCCAGACAAGGGTGGCTCATCC
TCCACAGCGGGGGCCAGTTCCTCCAGCCGCAAGGGTAGTA
GCAGTTCCGTGTGTAGCGTGGCCAGCAGCAGCGATATAAG
CCTCAGCTCCACCCGAGTGGAGCGCAGGGTCGAGAGCCTG
TTCGAGCAGGGAGTAGGCGTCATCGGAGGGCCCCCAGGAG
CTGAGGGCCAAGAACCCATAGTTGTGCTTTCCTCAGCCGA
AGCTGGCTCCGCCTCCAGCACCAGCACATTGACAGCAGAC
ACAGGA

hectd1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hectd1-201 (1)    Ensembl 9030
hectd1-205 (1)    Ensembl 745
hectd1-206 566
ncRNA hectd1-002 (1)    Ensembl 1761
hectd1-003 (1)    Ensembl 1221
hectd1-004 (1)    Ensembl 731
hectd1-007 (1)    Ensembl 587
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hectd1-206 Contained in:

Genome Resources: Vega_Trans:OTTDART00000055566 (1),  Ensembl_Trans:ENSDART00000152057 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB933401 (1) 575 nt
CITATIONS (2)