Transcript

hectd1-002

ID
ZDB-TSCRIPT-090929-8361
Name
hectd1-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000025641 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025641|OTTDARG00000020482|ZDB-GENE-030616-153 hectd1|no_translation hectd1-002 LG_none BX465838.15,BX324186.12 Danio rerio protein_coding KNOWN, 1761 bp
GTCGACCTCGATGAAGGCGAGGTGTTTTAGCACCCCCTGT
CGCTGAGCCGCATCGCTGCGTGTTTCTGACCGCTGCTGCT
GCTGCTGCCGCGGAGCCTCGTGATATGCGGAGCCTCGACT
AGTTCTCTCGTCTGCTCTCCATTTCACTCGATATTTCACC
CGTCGCCTTCCCGTTCACTTTGACCTCTACCTTACGACCA
ACAGAAGCGGGGAATGAAGCAATATTCACATCTCTCCGAC
TGATACAACTTCATTCCGAGACGAATTCTGTCCACCCTGT
GTGTGTTTTCTCGTCGTTCGGCGATAAACGACTTGATGAG
ACTTCAAGAGGACCAGTGACTGCCCCTGTTCATTTTTCTC
CTGCTGCTGGCAGGGTGACTGGGTGTCGGGTGGATTGGGA
AGTGGGGCATCATGGCGGACGTGGACCCGGACACGTTGCT
GGAATGGTTGCAGATGGGACAGGGCGATGAGCGGGATATG
CAGCTCATCGCCTTGGAGCAGCTCTGCATGCTGTTGCTCA
TGTCAGACAATGTGGACCGCTGCTTCGAAACGTGTCCTCC
ACGGACGTTTCTTCCAGCACTGTGTAAGATCTTTCTGGAT
GAGAGTGCACCCGATAATGTGCTGGAAGTGACAGCCAGAG
CCATCACCTACTACCTGGACGTGTCCGCTGAATGCACTCG
CAGGATTGTGGGAGTAGATGGAGCCATCAAAGCCCTGTGT
AACCGGCTGGTGGTGGTGGAGCTCAACAACAGGACCAGCA
GAGATCTGGCTGAACAATGTGTAAAGGTTGATGCAACAGA
TGCCAGCTATCCTTCAGTCAACACGTGTGTGCACTACTTG
AAGCTGCCGGAATATTCTTCAGAAGAGATTATGAGAGAGC
GCCTTCTCGCTGCCACTATGGAGAAGGGTTTCCACCTCAA
TTGAGCATGCTGTACCTTCAACATCCACCAACTCCCATAC
TGGTGAAGCCTGTTGTGTTTTGTTGCAGAAAAAAAAAAAG
CTGTGCTCTGACGAAATCCTATTCTCTTCAAGTACCCTAA
TAAACAGGAACGACAGTCCCATCGCAGCTCCACTAGCACC
TGAAAGCGAATAGGGTTTCCTCCTCCTCCCGCTCCACTGA
CTGCTTCACAAGGCCTTTCCCAGGTCAATCTACCGCTTTA
AGGGCTTGAGCCGCTGGCAGCCAGGGTAGTCTCTCCTCAC
CTACTGTGTTTACTGTCATTTACTCCAGGTTCAGTGTAAA
TTTAGGCATAGATCATCTTTTTCAGACCCAGAAATCATCA
CCATCTGCAGTGTCAGACCCTGGAAAACAAGCACACCTGC
TTCTGTAGAGCTTACTATAGAGTGTTTGGGCATTTCCTTA
ACAGGTTTTAAGTTTTACTAGTGCCTGCATTGCTGAAAAA
AACCCAACTAGTTTTCTTTTCATTTGTTTTACATAATCTG
TCTGCATACAATCATGCACATGCTTTTCTTTTTTTCCTTT
TTTGCTTCCGTTACCGTGTACGTTTTCAAATGTTCATTGC
CCTGCTTAAGGATCCCTGAGTGCATTTGTGTAATTTTTCA
ATAAAGCTATAGATACAGAAACACTGGTTCTGTGTGCAAG
GCACATTTAAAAAAAAAAACAAGCAAAAAGCAAGCTGTGC
TTTCCCTTGTATTTTCTTTGTATATTATAAACAATTATTT
AACTCAAGTTGCAGTTTGAAGTAAACAAATATTTTCAAAT
GTGTATGCTCCAAAAATAATCATTAAATTGTTTGCAAAGT
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations