ZFIN ID: ZDB-TSCRIPT-090929-8360
Transcript Name: hectd1-201
Previous Name: hectd1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025640 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025640|OTTDARG00000020482|ZDB-GENE-030616-153 hectd1|OTTDARP00000021079 hectd1-001 LG_none BX465838.15,BX324186.12 Danio rerio protein_coding KNOWN, 9030 bp
TACAATTTCGCAATATAGGTGAATGAATGTCTGATCTGTT
TTTTTGTCGACCTCGATGAAGGCGAGGTGTTTTAGCACCC
CCTGTCGCTGAGCCGCATCGCTGCGTGTTTCTGACCGCTG
CTGCTGCTGCTGCCGCGGAGCCTCGTGATATGCGGAGCCT
CGACTAGTTCTCTCGTCTGCTCTCCATTTCACTCGATATT
TCACCCGTCGCCTTCCCGTTCACTTTGACCTCTACCTTAC
GACCAACAGAAGCGGGGAATGAAGCAATATTCACATCTCT
CCGACTGATACAACTTCATTCCGAGACGAATTCTGTCCAC
CCTGTGTGTGTTTTCTCGTCGTTCGGCGATAAACGGTGAA
GACTTGATGAGACTTCAAGAGGACCAGTGACTGCCCCTGT
TCATTTTTCTCCTGCTGCTGGCAGGGTGACTGGGTGTCGG
GTGGATTGGGAAGTGGGGCATCATGGCGGACGTGGACCCG
GACACGTTGCTGGAATGGTTGCAGATGGGACAGGGCGATG
AGCGGGATATGCAGCTCATCGCCTTGGAGCAGCTCTGCAT
GCTGTTGCTCATGTCAGACAATGTGGACCGCTGCTTCGAA
ACGTGTCCTCCACGGACGTTTCTTCCAGCACTGTGTAAGA
TCTTTCTGGATGAGAGTGCACCCGATAATGTGCTGGAAGT
GACAGCCAGAGCCATCACCTACTACCTGGACGTGTCCGCT
GAATGCACTCGCAGGATTGTGGGAGTAGATGGAGCCATCA
AAGCCCTGTGTAACCGGCTGGTGGTGGTGGAGCTCAACAA
CAGGACCAGCAGAGATCTGGCTGAACAATGTGTAAAGGTT
CTGGAGCTGATCTGCACTCGGGAGTCTGGAGCTGTATTTG
AAGCAGGAGGACTGAACTGTGTGTTGAGCTTCATTAGGGA
CAGCGGTCATCTTGTGCACAAAGACACATTGCACTCTGCC
ATGGCAGTAGTTTCTCGCCTCTGCAGTAAGATGGAGCCAC
AGGACTCTTCCCTTGAGACATGCGTGGAGTCCCTCTCTAG
TCTGCTGAAACATGAAGACCATCAGGTTTCTGATGGAGCT
CTGCGCTGCTTCGCTTCACTGGCGGACCGGTTTACAAGAC
GTGGAGTTGACCCAGCCCCTTTAGCAAAGCATGGACTGAC
AGAAGAGTTGCTGTCCCGTATGGCTGCGGCAGGAGGTACT
GCATCTGGACCCTCCTCCACCTGCAAGCCTGGCAGAACCT
CTAGTGGAGCCGCTCCATCTGCTGCAGACTCGAAACTGAG
CAACCAAGTGTCCACCATCGTCAGCCTGCTGTCCACACTC
TGCAGAGGCTCACCACTTGTCACGCATGATCTTCTGCGCT
CAGAGCTGCCCGACTCTATGGAGAGTGCTCTACAGGGGGA
CGAGCGGTGTGTACTGGACACTATGCGGCTGGTGGACTTA
CTGCTGGTGTTGCTCTTTGAAGGCCGCAAGGCTTTGCCCA
AATCTACAGCTGGGTCTACAGGCCGTATTCCTGGGCTGCG
GCGTCTCGACAGCTCCGGGGAACGCTCCCACCGACAGCTT
ATTGACTGTATACGCAGCAAAGACACCGATGCTCTCATTG
ATGCCATTGATACCGGTGCATTTGAAGTGAATTTCATGGA
TGATGTAGGACAGACTCTCTTAAACTGGGCGTCTGCATTT
GGAACGCAAGAAATGGTGGAGTTCCTTTGCGAGAGAGGAG
CTGATGTCAATAGAGGTCAAAGGTCATCCTCCCTGCACTA
TGCTGCCTGTTTTGGCAGGCCACAAGTAGCCAAGACTCTA
TTGCGCCATGGGGCCAACCCTGACCTGAGAGATGAAGATG
GGAAAACTCCTTTAGACAAAGCTAGAGAGAGGGGACACAG
CGAGGTTGTAGCAATTCTCCAGTCTCCTGGAGACTGGATG
TGCCCTGTAAACAAAGGGGATGACAAGAAAAAGAAGGATG
TCAATAAAGAAGAGGAGGAAGGCAGTGAGCCGAAAGGTGA
CCCTGAAATGGCGCCAATCTACCTGAAAAGGCTACTTCCA
GTATTTGCACAGACCTTTCAGCAAACCATGCTGCCTTCAA
TAAGGAAAGCTAGTTTAGCTCTGATCAGAAAAATGGTGCA
CTACAGTTCTGAAGTTCTGCTTAAGGAAGTGTGTGATTCT
GATGCTGGACACAACTTGCCCACTGTACTTGTGGAGATCA
CTGCGACTGTGCTGGATCAGGAGGATGATGATGATGGTCA
CCTGCTGGCACTTCAGATCATTAGGGATCTAGTGGATAAG
GGAGGTGACGTGTTCTTAGATCAGCTGGCCAGGCTGGGTG
TCATTAATAAGGTGTCCACTCTGGCAGGACCCACGTCAGA
TGACGAAAATGAGGAAGAGGCCAAGCCTGAGAAGGATGAC
GAACCACAAGAGGATGCCAAAGAGATTCAACAGGGAAAGC
CTTACCACTGGAGAGACTGGTCCATCATCAGAGGCAGAGA
CTGCCTTTATATCTGGAGTGACGCAGCGGCTTTGGAGCTC
TCCAATGGCAGCAATGGTTGGTTCCGTTTTATCCTAGATG
GTAAACTAGCAACCATGTACTCCAGTGGAAGCCCAGAGGG
AGGCTCTGACAGCTCAGAAAGCAGAAGTGAGTTTCTTGAG
AAGCTGCAGCGTGCCAGAAGTCAAGTCAAACCAGTGACAG
CTAGTCAGCCCATCCTGTCCACACAAGGGCCCACCAAACT
CACTGTGGGTAATTGGTCTCTCACTTGTCTGAAAGAAGGT
GAGATTGCCATCCATAACTCAGATGGCCAGCAGGCTACCA
TCCTCAAAGAGGACTTGCCAGGCTTTGTGTTCGAGTCAAA
TCGAGGCACTAAGCACTCTTTCACTGCAGAAACTTCTCTA
GGGTCTGAATTTGTTACTGGCTGGACTGGTAAGCGAGGAA
GAAAGCTGAAATCCAAATTGGAAAAAACAAAACAGAAGGT
GAAAACCATGGCCAGAGATCTGTATGATGATCATTTCAAG
GCTGTGGAGAGCATGCCGAGAGGTGTAGTTGTCACTTTGA
GAAACATTGCCACTCAGCTGGAGTCTGCTTGGGAGCTACA
TACTAACAGACAGTGCATTGAAGGTGAAAACACATGGCGA
GACCTCATGAAAACAGCACTAGAGAATTTAATAGTAGTTC
TCAAGGATGAGAACACCATTTCTCCTTATGAAATGTGCAG
CAGTGGCCTCGTACAAGCGCTTTTTACTGTCCTCAGCAAT
AGTGTGGAACTTGACATAAAACATGATTGTAAGCCTCTGA
TGGAAAGAATAAATGTGTTCAAGACTGCATTCACTGAAAA
TGAAGATGACGAAAGCCGACCCGCAGTTGCCTTAATCCGC
AAACTGATAGCAGTGCTGGAATCAATAGAGCGGCTACCTT
TGCACTTATATGATACCCCAGGCTCAACATATAATTTACA
GATACTGACAAGGAGGTTACGCTTCCGCCTGGAACGTGCT
CCAGGTGAAACAGCCCTGATTGATCGAACTGGAAGAATGT
TGAAGATGGAGCCGCTGGCCACTGTTGAGTCACTTGAGCA
GTATCTGCTCAAGATGGTGGCCAAGCAGTGGTATGACTTT
GACCGGTCCTCATTCATCTTCGTTAGGAAGCTCAGAGAGG
GCCAGAACTTCACCTTCAGGCACCAGCATGACTTTGATGA
GAATGGAATTGTGTATTGGATTGGTACCAATGCAAAGACT
GCGTATGAATGGGTGAACCCTGCTGCTTATGGATTAGTGG
TTGTGACCTCCTCCGAGGGCAGAAACTTGCCTTATGGCCG
ACTTGAAGACATCTTGAGCAGAGACAGCTCCGCCCTCAAC
TGTCACACCAACGATGATAAAAACGCCTGGTTTGCCATTG
ACCTCGGTTTATGGTTTGTCCCCTCTGCATACACACTTCG
TCACGCTCGTGGATACGGTCGGTCCGCTCTCAGAAATTGG
GTGTTTCAAGTGTCCAAAGATGGTCAGAACTGGATGACTC
TCTACACCCACGTAGATGACAGCTCTCTCAATGAACCAGG
GTCAACAGCCACATGGCCTCTGGATCCATCCAAAGATGAG
AAGCAGGGCTGGAGACACATTCGTATTAAACAGATGGGAA
AGAATGCCAGCGGACAAACACACTACCTCTCCCTGTCTGG
TCTAGAGATCTATGGCACTGTTACTGGTGTGTGTGAGGAT
CAGCTGGGTAAAGCAGTGAAAGAGGCAGAGGCCAACCTGA
GACGGCAGCGGCGACTCTTTCGCTCGCAGGTGATGAAGTA
CATTGTTCCAGGAGCGCGGGTGGTGCGAGGCATTGACTGG
AAGTGGCGAGACCAGGATGGCAATCCTGCTGGAGAAGGCA
CTGTGACTGGAGAAGCCCACAATGGCTGGATTGATGTCAC
CTGGGATGCCGGTGGCTCAAACTCATATCGTATGGGTGCG
GAAGGGAAGTTTGACCTCAAGCTTGCGCCAGGGTACGACC
CTGAGTCAGCGCCATCACCCAAACCTGTCTCATCCACTGT
TGCAGGCACACCGCAGTCCTGGAGCAGCCTGGTGAAAAAT
AACTGTCCAGACAAGGGTGGCTCATCCTCCACAGCGGGGG
CCAGTTCCTCCAGCCGCAAGGGTAGTAGCAGTTCCGTGTG
TAGCGTGGCCAGCAGCAGCGATATAAGCCTCAGCTCCACC
CGAGTGGAGCGCAGGGTCGAGAGCCTGTTCGAGCAGGGAG
TAGGCGTCATCGGAGGGCCCCCAGGAGCTGAGGGCCAAGA
ACCCATAGTTGTGCTTTCCTCAGCCGAAGCTGGCTCCGCC
TCCAGCACCAGCACATTGACAGCAGACACAGGAAGCGAAA
GCGAGCGTAAAACACCAGGACCTGATGGCACTAGACAGTC
AGCGGAGTCCACAGCCATCTCTATGGGAATCGTGAGCGTG
AGCTCGCCTGATGTCAGCTCTGTTTCAGAGTCGTCTAGTA
AAGACGCTGCATCCCAGAGGCCCTTGTGCTCTGCCACCAG
TGCGCGGCTGTCTGTCAGTTCACTTTTGGCAGCTGGAGCA
CCCATGAGTTCTAGTGCCAGCGTCCCCAACCTGTCCTCTC
GCGAGGCCAGCCTGATGGAGTCGTTCGTTCGGAGGGCACC
CAACATGTCTCGCACTAATGCCACCAACAACATGAACCTG
AGCCGAAGCAGCAGTGATAACAACACTAACACGCTGGGAC
GAAATGTCATGAGCACTGCCACTTCTCCACTTATGGGTGC
GCAGAGCTTTCCTAACCTTACAACCACTGGTACCACCTCA
ACTGTTACAATGTCCACCTCTATAGTAACCAGCAGCAATA
ATGTAGCCACGGCAACTACAGGTTTGTCCGTCGGCCAGTT
GCTCAGTAACACGCTGACGACCAGCCTGACCTCTACATCT
AGCGAGAGTGACACAGACTTCCTGGACAGTTGTCGGGCCA
ACACTTTGCTTGCAGAGTTGGATGATGAAGAAGATTTGCC
GGAGCCAGATGATGACGATGATGAAAATGAGGATGACAAT
CAGGAGGAACAGGAGTATGAGGAAGTTTTGGTACGGTCCA
GGGTCAACCTTGGTTACCACGTTCATATTCATAGGGAGGA
AGAGGAGTATGAAACCAAAGGGGGCCGTCGCAGGACCTGG
GATGACGACTTTGTGCTGAAACGACAGTTTTCTGCTTTAG
TACCTGCATTTGACCCTAGACCAGGCAGGACCAACGTCCA
GCAAACTACTGACCTGGAAATCCCCCCACCAGGAACACCT
CGTTCAGAGGTACAGGAGGAGGTGGAGTGCGCTCCTTCAC
CTCGTCTGGCTCTCATCTTAAAAGTAGCAGGTCTAGGAAC
TACTCGAGAAGTAGAACTACCTCTCACCAATTACAAGTCC
ACCATTTTCTATTATGTCCAAAAACTTCTCCAGCTGTCAT
GCAACGGTGCTATTAAACCTGACAAGCTCAGACGCATCTG
GGAGCCTACGTATACGATAATGTATAGAGAATTGAAGGAT
TCCGACAAAGAAAGAGAGAGCGGAAAGATGGGTTGCTGGT
CTGTAGAGCATGTGGAACAGTACCTTGGCACAGATGAATT
ACCAAAGAATGACTTGATAACCTACATGCAGAAGAATGCA
GACTCAACTTTCCTGCGCCACTGGAAATTAACCGGCTCTA
ATAAAAGTATTAGGAAAAACAGAAATTGTTCGCAGCTCAT
AGCTGCATACAAGGACTTCTGTGAGCGTGGCTGCAGATCT
TCAGGCCTGAGTTCAGGGACGTTGTCCACGACGCAAAGCT
GTGATATCTTGAGTGCTGCAAGAGAGCAGGCTCAGGCTAA
AGCGGGCTCGGGTCAGAGCGCCTGCAGCGTAGAGGATGTA
CTGCAGCTCTTGCGCATCCTTTTCACCATCGGAGGAGAAC
CTACATCTGGACGCACACTACAGGAAGATGTGGAAGAGCT
ACAGTTCAATGCATCACCTGAGGAATTCACCAGCAAAAAA
ATTACAACCAAAATCCTGCAGCAGATTGAAGAGCCATTGG
CTCTGGCTAGTGGGGCTCTCCCCGACTGGTGTGAACAGTT
AACCAGCAAGTGTCCTTTCCTCATACCCTTTGAAACCCGG
CAGCTTTATTTTACCTGCACTGCATTTGGAGCCTCTAGGG
CAATTGTTTGGCTCCAGAATCGAAGGGAAGCCACTATGGA
GCGTTCCCGGCCATCCACGACTGTTCGCCGTGATGATCCC
GGAGAGTTCCGTGTTGGTCGGCTTAAGCATGAACGTGTCA
AGGTGCCTCGAGGAGAGAGTATGATGGAGTGGGCTGAGAG
TGTGATGCAGATACACGCTGACAGAAAGTCTGTACTGGAG
GTGGAGTTCCAAGGGGAGGAGGGCACTGGTCTCGGACCCA
CCCTGGAGTTCTATGCTCTTGTTGCGGCAGAGTTTCAGAG
GACCTCCCTTGGCATCTGGCTCTGTGATGATGACTTCCCA
GATGATGAGTCACGTCAGGTGGATCTGGGCGGTGGCTTGA
AACCGCCAGGCTATTACGTGCAGCGTTCCTGCGGCCTTTT
CCCTGCTCCCTTCCCTCAGGACAGCGATGAACTGGAGCGT
ATTACCAAACTTTTCTTGTTCCTTGGCATCTTTCTGGCCA
AATGCATCCAGGACAACCGGCTCGTGGATCTGCCCATATC
CCAGCCTTTCTTTAAACTGCTCTGTATGGGTGACATCAAA
AGCAACATGAGTAAGCTACTTTATCAAACCCGTGGTGAGT
CGGACTGTCACTTCTCTGAAATCCAGTCTGAGGCCTCCAC
CGAGGAGGGTCAGGACACGTACTCTGTGGGTAGTTTTGAT
GAAGACTCCAAGTCTGAGTTTATTCTTGACCCACCGAAGC
CCAAACCACCAGCCTGGTATCATGGCATCTTGACCTGGGA
GGACTTTGAACTGGTAAACCCTCACAGAGCACTGTTTCTT
AAAGAGCTGAAGGCACTTTCTGTGAAGCGCAGGCAGATTC
TAGGCAATAAGAGTCTGTCCGAGGATGAGAAGAACACACG
GCTTCAGGATCTCATGCTGAAGAATCCTATGGGCTCTGGC
CCTCCACTGTGTGTTGAAGATCTAGGATTAAATTTCCAGT
TCTGTCCATCATCCAAAGTACATGGTTTCTCTTCTGTAGA
CTTGAAGCCTAATGGAGAGGATGAGATGGTCACCATGGAC
AATGCAGAGGAGTATGTAGAGCTGATGTTTGACTTCTGCA
TGCACACAGGAATCCAGAAGCAAATGGAGGCCTTTAGAGA
GGGCTTTAATAAAGTGTTCCCTATGGAGAAACTGAGCTCA
TTTAGCCATAAAGAGGTGCAGATGATCCTGTGTGGAAACC
AGTCTCCATCCTGGACTGCTGAAGACATTGTTAACTACAC
AGAACCTAAACTGGGCTATACACGGGACAGTCCTGGTTTC
CTGCGTTTCGTGCGGGTTCTGTGTGGAATGTCTTCTGATG
AGAGGAAAGCTTTCCTCCAGTTCACTACAGGCTGCTCAAC
TCTGCCCCCTGGTGGACTGGCCAACCTCCATCCACGGCTC
ACAATAGTCCGAAAGGTTGATGCAACAGATGCCAGCTATC
CTTCAGTCAACACGTGTGTGCACTACTTGAAGCTGCCGGA
ATATTCTTCAGAAGAGATTATGAGAGAGCGCCTTCTCGCT
GCCACTATGGAGAAGGGTTTCCACCTCAATTGAGCATGCT
GTACCTTCAACATCCACCAACTCCCATACTGGTGAAGCCT
GTTGTGTTTTGTTGCAGAAAAAAAAAAAGCTGTGCTCTGA
CGAAATCCTATTCTCTTCAAGTACCCTAATAAACAGGAAC
GACAGTCCCATCGCAGCTCCACTAGCACCTGAAAGCGAAT
AGGGTTTCCTCCTCCTCCCGCTCCACTGACTGCTTCACAA
GGCCTTTCCCAGGTCAATCTACCGCTTTAAGGGCTTGAGC
CGCTGGCAGCCAGGGTAGTCTCTCCTCACCTACTGTGTTT
ACTGTCATTTACTCCAGGTTCAGTGTAAATTTAGGCATAG
ATCATCTTTTTCAGACCCAGAAATCATCACCATCTGCAGT
GTCAGACCCTGGAAAACAAGCACACCTGCTTCTGTAGAGC
TTACTATAGAGTGTTTGGGCATTTCCTTAACAGGTTTTAA
GTTTTACTAGTGCCTGCATTGCTGAAAAAAACCCAACTAG
TTTTCTTTTCATTTGTTTTACATAATCTGTCTGCATACAA
TCATGCACATGCTTTTCTTTTTTTCCTTTTTTGCTTCCGT
TACCGTGTACGTTTTCAAATGTTCATTGCCCTGCTTAAGG
ATCCCTGAGTGCATTTGTGTAATTTTTCAATAAAGCTATA
GATACAGAAACACTGGTTCTGTGTGCAAGGCACATTTAAA
AAAAAAAACAAGCAAAAAGCAAGCTGTGCTTTCCCTTGTA
TTTTCTTTGTATATTATAAACAATTATTTAACTCAAGTTG
CAGTTTGAAGTAAACAAATATTTTCAAATGTGTATGCTCC
AAAAATAATCATTAAATTGTTTGCAAAGTA

hectd1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hectd1-201 9030
hectd1-205 (1)    Ensembl 745
hectd1-206 (1)    Ensembl 566
ncRNA hectd1-002 (1)    Ensembl 1761
hectd1-003 (1)    Ensembl 1221
hectd1-004 (1)    Ensembl 731
hectd1-007 (1)    Ensembl 587
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hectd1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000025640 (1),  Ensembl_Trans:ENSDART00000076344 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DN903226 (1) 836 nt
GenBank:BM182784 (1) 691 nt
GenBank:CT717897 (1) 675 nt
GenBank:CD595731 (1) 650 nt
GenBank:AI721635 (1) 585 nt
GenBank:BM184193 (1) 575 nt
GenBank:AI877624 (1) 573 nt
GenBank:CT598708 (1) 552 nt
CITATIONS (2)