Transcript

hectd1-205

ID
ZDB-TSCRIPT-120702-298
Name
hectd1-205
Previous Names
  • hectd1-006
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000055565 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055565|OTTDARG00000020482|ZDB-GENE-030616-153 hectd1|OTTDARP00000043580 hectd1-006 LG_none BX465838.15,BX324186.12 Danio rerio protein_coding KNOWN, 745 bp
GAGGAAGAAAGCTGAAATCCAAATTGGAAAAAACAAAACA
GAAGGTGAAAACCATGGCCAGAGATCTGTATGATGATCAT
TTCAAGGCTGTGGAGAGCATGCCGAGAGGTGTAGTTGTCA
CTTTGAGAAACATTGCCACTCAGCTGGAGTCTGCTTGGGA
GCTACATACTAACAGACAGTGCATTGAAGGTGAAAACACA
TGGCGAGACCTCATGAAAACAGCACTAGAGAATTTAATAG
TAGTTCTCAAGGATGAGAACACCATTTCTCCTTATGAAAT
GTGCAGCAGTGGCCTCGTACAAGCGCTTTTTACTGTCCTC
AGCAATAGTGTGGAACTTGACATAAAACATGATTGTAAGC
CTCTGATGGAAAGAATAAATGTGTTCAAGACTGCATTCAC
TGAAAATGAAGATGACGAAAGCCGACCCGCAGTTGCCTTA
ATCCGCAAACTGATAGCAGTGCTGGAATCAATAGAGCGGC
TACCTTTGCACTTATATGATACCCCAGGCTCAACATATAA
TTTACAGATACTGACAAGGAGGTTACGCTTCCGCCTGGAA
CGTGCTCCAGGAACACCTCGTTCAGAGGTACAGGAGGAGG
TGGAGTGCGCTCCTTCACCTCGTCTGGCTCTCATCTTAAA
AGTAGCAGGTCTAGGAACTACTCGAGAAGTAGAACTACCT
CTCACCAATTACAAGTCCACCATTTTCTATTATGTCCAAA
AACTTCTCCAGCTGTCATGCAACGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations