ZFIN ID: ZDB-TSCRIPT-120213-91
Transcript Name: eif1b-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053202 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053202|OTTDARG00000014153|ZDB-GENE-030131-956 eif1b|no_translation eif1b-003 LG_ BX323079.7 Danio rerio protein_coding KNOWN, 940 bp
GTCAAACGCTACTGGAGCGCCGAGAAACCCCTTCATTAAT
CAGGCCAGATTACCGAGAAATCAAAACCGCGAGACCACCC
GTTGTCGTCCGAAAGGAAAGGGAATCTTATCGTATGTCCG
CTATCCAGAACCTCCAAACTTTTGACCCCTTTGCTGATGC
AACTAAGGGTGATGATCGGCTCCCAGCTGGGACTGAGGAC
TACATCCACATAAGAATTCAACAGCGGAACGGGCGGAAGA
CTCTGACCACGGTTCAGGGCATAGCCGATGACTATGATAA
AAAGAAGCTAGTCAAGGCCTTCAAGAAGGTTGTCGCTGTT
AAATAATTGACACTCTAAAGTGGTTTACGGTTACAAGTGT
GGGCCATTTTTAACATCCTCATTTGCATCCACAGAAATTT
GCCTGCAATGGGACTGTGATTGAGCACCCTGAGTATGGTG
AAGTAATTCAGCTGCAAGGCGATCAGCGCAAGAACATTTG
CCAGTTTCTTACTGATGTGAGTATTTTATCCATAACCTAA
TTGCATTATAATTGGAGCTGAAGTAATCAATACATTTCAT
TGATTCATTATGAACTTGTATATAATCTGATGAGGTTTTT
CGTTGTAGCTAATGTAATCGATGCATTTTTATCCCGCAGA
TTGAACTGGCCAAAGAGGAGCAGCTCAAAGTCCACGGGTT
CTAAAAGCGGATGTGAACTGACCCCTTCCCTCCCCAACTC
TAAACCCAAGCTTCCCTGTTGTTGTGCTGCTGTTCCCCCC
TCCCCCTCAGCAGCCTCCCCTCAAGGAAAAAAAAGCTGAA
AATGATTACCTCTGATTTGAGACTCTTTAGTATGACACCC
TTATCAAAACGACCAGTCCTGTTCGAGCATGGACAGACGA
CAAGGCAAATAATGCGGGATAAATGATTTTCGTTTCTGTC
CCTTCCTTTAGTATTTTATT

eif1b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA eif1b-001 (1) 1336
ncRNA eif1b-002 (1) 773
eif1b-003 940
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
eif1b-003 Contained in:
[BAC] DKEYP-113D7 (1)
OTHER eif1b-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053202 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EE719010 (1) 949bp
    CITATIONS (1)