header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3579
Transcript Name: eif1b-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000016892 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000016892|OTTDARG00000014153|ZDB-GENE-030131-956 eif1b|OTTDARP00000014318 eif1b-001 LG_ BX323079.7 Danio rerio protein_coding KNOWN, 1336 bp
TGCGTTTCGGGTGACGTCATGTCCCCGGCAGCTGAAGGCG
GGGCTACACAGAGCTGTTTTCAAGTGCTCACCAGCGACTG
TCGCCATTTTGTAAGCTCGTCAAACGCTACTGGAGCGCCG
AGAAACCCCTTCATTAATCAGGCCAGATTACCGAGAAATC
AAAACCGCGAGACCACCCGTTGTCGTCCGAAAGGAAAGGG
AATCTTATCGTATGTCCGCTATCCAGAACCTCCAAACTTT
TGACCCCTTTGCTGATGCAACTAAGGGTGATGATCGGCTC
CCAGCTGGGACTGAGGACTACATCCACATAAGAATTCAAC
AGCGGAACGGGCGGAAGACTCTGACCACGGTTCAGGGCAT
AGCCGATGACTATGATAAAAAGAAGCTAGTCAAGGCCTTC
AAGAAGAAATTTGCCTGCAATGGGACTGTGATTGAGCACC
CTGAGTATGGTGAAGTAATTCAGCTGCAAGGCGATCAGCG
CAAGAACATTTGCCAGTTTCTTACTGATATTGAACTGGCC
AAAGAGGAGCAGCTCAAAGTCCACGGGTTCTAAAAGCGGA
TGTGAACTGACCCCTTCCCTCCCCAACTCTAAACCCAAGC
TTCCCTGTTGTTGTGCTGCTGTTCCCCCCTCCCCCTCAGC
AGCCTCCCCTCAAGGAAAAAAAAGCTGAAAATGATTACCT
CTGATTTGAGACTCTTTAGTATGACACCCTTATCAAAACG
ACCAGTCCTGTTCGAGCATGGACAGACGACAAGGCAAATA
ATGCGGGATAAATGATTTTCGTTTCTGTCCCTTCCTTTAG
TATTTTATTTTTTATTTTAGTTCATCTTGTGCCGCTCTCA
AGCGCAAATTCCATGTAACTTTCTTTCTCTTTGTTTTGTA
TGAGGTGTTTCAATAAACCTTCAGATGCCACGTTTTGCAC
AATCTTTACGTTCGACAGGCCGGGGGTGTGGATGGGGGCA
GTTTGTGTGTTGATTTTTCTTGATTCATATTTAAGAACCA
CCTTAAACTAATCTGCATTTTCAGTTATGATGTGGGCCAG
CCTGCTTCAGGGTTACATTGGTGTGCCGTTTGGGCACGAA
TCACGGCAACCCCATCTCGTCTCATTATGCATCTCTAACT
GCCTTTTTTATCCTTGTTTTTCACAATATGCATAATTTCA
ATTTTCTAAACTTGTAATACCATATTTTGTTTTCTGGTCT
GGAATAAACGGTATCCCATACTTTGGATGTTTTAATTTTT
TACTTATGTATAAACAATGGAAATTACTTACTCTGATTAT
TGCGCAAGAAGCACTCATAGATCATTACAAAAGTAAAGAA
GTAGCTCTTAATGCTA

eif1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA eif1b-001 1336
ncRNA eif1b-002 (1) 773
eif1b-003 (1) 940
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
eif1b-001 Contained in:
[BAC] DKEYP-113D7 (1)
OTHER eif1b-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000016892 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY398352 (1) 1247bp
    GenBank:BC067620 (1) 1119bp
    GenBank:EH483506 (1) 1044bp
    GenBank:BC049025 (1) 839bp
    GenBank:CV489805 (1) 777bp
    CITATIONS (1)