ZFIN ID: ZDB-TSCRIPT-120213-861
Transcript Name: eif1b-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053201 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053201|OTTDARG00000014153|ZDB-GENE-030131-956 eif1b|no_translation eif1b-002 LG_ BX323079.7 Danio rerio protein_coding KNOWN, 773 bp
ATTTTGTAAGCTCGTCAAACGCTACTGGAGCGCCGAGAAA
CCCCTTCATTAATCAGGCCAGATTACCGAGAAATCAAAAC
CGCGAGACCACCCGTTGTCGTCCGAAAGGAAAGGGAATCT
TATCGTATGTCCGCTATCCAGAACCTCCAAACTTTTGACC
CCTTTGCTGATGCAACTAAGGGTGATGATCGGCTCCCAGC
TGGGACTGAGGACTACATCCACATAAGAATTCAACAGCGG
AACGGGCGGAAGACTCTGACCACGGTTCAGGGCATAGCCG
ATGACTATGATAAAAAGAAGCTAGTCAAGGCCTTCAAGAA
GGTTGTCGCTGTTAAATAATTGACACTCTAAAGTGGTTTA
CGGTTACAAGTGTGGGCCATTTTTAACATCCTCATTTGCA
TCCACAGAAATTTGCCTGCAATGGGACTGTGATTGAGCAC
CCTGAGTATGGTGAAGTAATTCAGCTGCAAGGCGATCAGC
GCAAGAACATTTGCCAGTTTCTTACTGATATTGAACTGGC
CAAAGAGGAGCAGCTCAAAGTCCACGGGTTCTAAAAGCGG
ATGTGAACTGACCCCTTCCCTCCCCAACTCTAAACCCAAG
CTTCCCTGTTGTTGTGCTGCTGTTCCCCCCTCCCCCTCAG
CAGCCTCCCCTCAAGGAAAAAAAAGCTGAAAATGATTACC
TCTGATTTGAGACTCTTTAGTATGACACCCTTATCAAAAC
GACCAGTCCTGTTCGAGCATGGACAGACGACAAGGCAAAT
AATGCGGGATAAA

eif1b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA eif1b-001 (1) 1336
ncRNA eif1b-002 773
eif1b-003 (1) 940
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
eif1b-002 Contained in:
[BAC] DKEYP-113D7 (1)
OTHER eif1b-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053201 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EV760787 (1) 927bp
    GenBank:DV595171 (1) 791bp
    CITATIONS (1)