ZFIN ID: ZDB-TSCRIPT-120213-602
Transcript Name: gpatch8-002
Previous Name: dkey-260c8.3-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053684 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053684|OTTDARG00000037547|ZDB-GENE-030131-6966 gpatch8|OTTDARP00000042204 DKEY-260C8.3-002 LG_none BX640549.17,CR388062.19 Danio rerio protein_coding NOVEL, 569 bp
ATGGCCGACAGATTCTCTAGATTCAACGAAGAACGTGATT
TTCAGGGTGGAAATCACTTTGACCAGTATGAGGAAGGTCA
GTTGGAGTTGGAACAGGCCTCTTTGGACAAGCCCATAGAA
TCGCGAATTGGCCCCAATTAGCTAAGCAGCTCTGACCCGG
ATAACATTGGGCACCGGCTCCTTCAGAAACATGGCTGGAA
GTTGGGTCAAGGCCTGGGCAAAACCATGCAGGGTAAGGTT
TGTAGGACCTCCCCAACTGTATGTTTGTGTGTATGTTTGA
GTAAGTGTGCGTGTGTGTGTGGATGTTTTTTTCTTGAAAT
AATACATAATAACTCTCCCCCTTTTACAGTGTAGCCTAAC
GGCTTCTCTTAGTTCTTCTCTATACGCTTACAATCACTAA
ACGCTCTCTGCTCAAAATACCAGTGCAACGATTTGAAACT
CATACCAAAATGGAATCAGTAAACATATTGTAGAAATTAT
CCATTTTTTCCCCCTCCTGATTGTGTTCAGAATTCACCCA
TGTTAGAATAGTACTTGTATATATTAGTTTAATGTATGTT
TGGCTGCAA

gpatch8 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA gpatch8-001 (1) 7025
aberrant processed transcript gpatch8-002 569
ncRNA gpatch8-003 (1) 421
gpatch8-004 (1) 572
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gpatch8-002 Contained in:
OTHER gpatch8-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053684 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AI657659 (1) 568bp
    CITATIONS (1)