ZFIN ID: ZDB-TSCRIPT-120213-987
Transcript Name: gpatch8-001
Previous Name: dkey-260c8.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053682 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053682|OTTDARG00000037547|ZDB-GENE-030131-6966 gpatch8|OTTDARP00000042203 DKEY-260C8.3-001 LG_none BX640549.17,CR388062.19 Danio rerio protein_coding NOVEL, 7025 bp
AACAAGTCGGAACGCAGGAGACGAGGCGAACAGGAGAGAA
AATGGCCGACAGATTCTCTAGATTCAACGAAGAACGTGAT
TTTCAGGGTGGAAATCACTTTGACCAGTATGAGGAAGGTC
AGTTGGAGTTGGAACAGGCCTCTTTGGACAAGCCCATAGA
ATCGGATAACATTGGGCACCGGCTCCTTCAGAAACATGGC
TGGAAGTTGGGTCAAGGCCTGGGCAAAACCATGCAGGGAC
GAACTGACCCTGTCCCGATCGTGCTCAAATATGACGTCAT
GGGAATGGGGCGAATGGAAATGGAGCTGGACTATGCAGAA
GATGCCACAGAGAAGCGTCGAGTATTGGAAGTGGAAAAAG
AAGACACTGAGGAACTGCGTCAAAAATACAAGGATTTTGC
AGAGAAAGAAAAAGCTATTGCCAAAGCTTTAGAGGACCTA
AGGGCCAACTTCTACTGTGAACTGTGTGATAAGCAATACC
AGAAGCATCAGGAGTTTGACAATCACATCAACTCCTACGA
TCATGCACACAAGCAGAGACTGAAGGAGCTAAAGCAGAGA
GAGTTTGCTCGGAATGTGTCTTCTCGTTCTAGAAAGGATG
GCAAAAAACAGGAGAAGATGCTACGGCGGCTTCATGAATT
GGCTGAACAGAGGAAACAACAAGACCATGTTCCTGGCAGT
GGTCCCATGTTTAAAACCACCACAGTGGCAGTAGATGGAG
AAAAGGGTGAAGACTCAATGGATGGTGTACCTATGACAGT
GGATATCAGTACAGATTCTTTTGAAGAAAAGTCAGCATGT
GGTGTTGGTGGTCAAGGTTCCCCTAGATCAGGCCCTTCCA
TTAGCTTTGGGTTTAATAAAAGTAGCTCTTCTCCAACTCC
CTCTGGAGGCACACAAGCTCCCAAAGTCAGTGTGTCATTC
TCTTTTGCTAAAAAAGCCCCAGTAAAACTTGAAACGGCTG
CAGCTGTCTTTGCAGACCATGCTGAAGAGACAGTAGAAGG
TGAAGAAGGACAGGAAGAGGGAGGAGAAAATACTGGAGTA
GAGGATGTAGGAATGACATCTACCAATGATATCCCACAGG
CAGTTGCCATTAGTTTGGAGGAAGGTGGGAGTGGGGGTGG
TGGTGGTAGTGAGGGCGATGAAGAGCAGTTACAACCAGAC
GATGGAGGAACCCTGGCCTCTACTTTAAACAAGCTAAAGA
TGATGATGAAAAAGGAAGAAGGTTACTCTGGACAAGAGCC
ACAGTATTATCATTATGTACCACCTGCACATTGTCGAGTC
AAGCCTCATTTTCAGTTTCTGCTTTTTATGAAGGCTTCTG
ACCAGTGTGATGAGAAGGAGGATGGAGTAAAAGACGAGAA
GGCAGAAGTAGGCAATGATGGAGAGCAAAAACATATTGAA
GTAACCATTGACACATCTGAAAAAGATACTGAGAATGAAC
CTACACAGGCTCAAAACACTACTCCCTCTTCTGCATCAGC
TAAAGAAAAGGCAGATGAAGAATCTGGTAGTATGTCGACA
GGACATGATGATACTACAGAAGTGGAAAGCTTGCCCCAAC
CAACTGACAGCAAGCAAGTGATGTCCCAACCTCCAGATAC
AGGTCCCCGCATGCCAACTGGGCCTTTTTTCCCTGTGTTA
AGTAAAGATGAAAGCACTACCTTGCAATGGCCTTCTGAGT
TGTTGGAGTTTACTAAGGCCCAGCCAGCCCTTTCCTACAG
CTGTAATCCACTTTACTTTGACTTCAAGCTTTCAAGAAAC
AAAGGCAACTGGGCAGGCAAAAATAGCAAACCTGTCAAGC
CAGTTAGCACTGAAGAACAAGAGGCGTCTAAGCCTGAAAA
AACAGACAGCACTCCTGACACTAGTGGTGTTGCGTGTACT
ACTAAAACAGTTGGAGGACCCAGTACGTCTCAAAAAGAAC
AATCCTCACTGAAAGTCGAGGGTGCTGAGAGAGAGAACAA
TGAGCAGAAATTACCAAGTAATGATGATGTGACTGCAGGG
TCTAAGAAAAAGAAAAAGAAGAAACACAAAAAGTCAGGCA
AGCATTCTAAACGCAAAGAGAAAGCAGCAGTGGAGGGTGA
GTTAGTGAATGAGACACCAGGTGGAAAAACTAAAAAAAAG
AAGAAGCATAAAAGGAAGAAAAGCAAAAATAAACCACGTG
ACGCTGAAGGAGTTGCACCAGAGGAAGAGGGCAATAAGGA
CAAAGAGAAAGCCAAGGATGACAAAGATGGAGTAGCCACT
GCTCAGTCATCTGGAGTAGGCGCAACCAATGAGGGAGTAA
AGAGAAAACGGTCCCACAAAATGTCTGGAGTTGAGCAAAC
CAGTGCAGGAAAGCCCAGCTCTACAGAGGAGCACAATGGT
ACTAAGCGTCTTAAATCTGACACCAACACACCTGCTGCCT
CATGCTCTGCTTCAGCCCAAAAGAGCTTAGGGGGAGGTCA
ACCTCCAAGTAGCGACAGCGAGGAGGATGGAGGATCATCC
TCTCAACGGTCTCGACCACCTCAACGTCGCTCCACACCGA
CACGTGAGCAGCGCAGACACCGAAGTGATGATTCTGGACG
TTCACGTAGTAGGTCATCCCATAGAGGAGACCACAACCAT
AGACGCCACAGAGGTCAAAAGTCACACAGCCGATCTTACT
CTACTAGCTCTGAGCGTTCCTCAGCAGGGAGCAGTGCTTA
CAGTCGCCGTAGCCGTAGCTACACAGACAGTTACAGTGAC
TACAGTGAAGGACGTCGCCACAGATCAAGAAGGCCTTCCT
CAGACTCAGACTATGACAGGCGTGATGGTGGCCGATCTCA
CAGGCGACGTTACTCATCTTCTTCAGAAGAGGACTCGCGT
TCACGATCGCGCTCTCGAAGCCGCAGAAAACATCATCGAC
GGAGACACCAAAGGAGTAGTAGTCGCAGCTCCAGTCGAAG
TAGTTGGAGTAGCAGTGCTCGTTCTTACAGACGCAGTAGC
TACAGTCGCAGCCGTAGCTCTGCTAGTCGTTCATCTAGCT
CTACCAAGGGCTCTCCACATCGGCATGGTCACAGTCGGCG
ATCTGACAGCTCAACACGGCGGCGGGATTTCAATCGGTCA
CGAATTTACCGATCTCAGTCTCCAAGATCCTCTTCCCGCA
CACAAAACCGAAACAGCAACTCTTCATCGACACTAGGAAC
AAGAGGTGGTGGAGCTTCTTCAAAGGAGGGAGGAGGTGCT
GCAGAACATCGAAATTCATTCACAGCCCGACAACTCTTGG
AGCGAATTCAATCTAGAAAAGGAGGGGATCAATCTGGTGC
AGGCACTAAGACGGGCATCAAGATCAAGGATCCTCCACAG
GGATACTTTGGCCCCAAACTCCCCCCCGCCCTTGGAAACA
AAAGTATGTTACCTCTTTTTGGCAAGCTCCAAGCAGGAAA
GAAGCCCCCATTACTTCCTTTTACACGTTCAACTGATGGT
GTAAAGTCTGAGCAGAGCAAAATCTCTGATAGTAGTGAAG
TTATCCTGGTAGAACCTATCCGTGAATTTCCTCCCCCTCC
TCCACCACCTCAACCAGCAGTTCAACAACAAAAGCAGCAG
CTGGAGGAGGCTGTATCAAGTGCAGCCGTGCTCGAGGAGC
CCAGACATCCATCCTCAGACCCTCCAGTTCTTCATGAGTC
TCAACCACAATATGAGCAGGATCCAGCAATGATGATGTCA
CAATACCAAGGTGAGAGACAAGACCCCAATAATCACATGC
TAGATGGGCATCTAATGGGGCCTGATATAGGTCAACAACC
TACTATGCATGCCTACCCTGGTTACCCTGCTACTATGGAG
GATGGAGACATGGGCATGGAAGCTGAAGAGGATGGTCTTG
CACCTTTAGAAAGTCAACCAATCACCTTCACCCCAGAGGA
AATGGAGAAGTACAGCAAGTTGCAGCAGGCAGCCCAACAG
CATATTCAACAGCAACTGTTGGCCAAGCAGGTGAAGAGCT
TTCCCTCAGCTGCAGCCGCAGCAGCTAATTTGGCAGCAGC
AGCTAATCTTGCCCCTGCCCCACCACCACCACCAACTGCA
CTGCAGCAAATCCACATCCAGCAACCCACTGTTTCTGCAG
CTTCTGCTACCTCTATTACTACAGTGCAGCACGCCATCTT
ACAGCACCATGCTGCTGCTACAGCCATGGGCATCCATCCT
CATACTGCACATCATCCACACCATGCCCAGCTAGCCCAGG
TGCACCACATACCTCAACATCACCTAACCCCTATCTCCTT
GTCGCCATTGGGCCATTCTTTGGGCCATTCACTTGGTCAC
TCTTTAGGACACACTGGCCTGATTCCAGCCCATCACACTG
CCTTCCTTTCAGGCCAACCCATACATATTATACCAGCCTC
TGCGCTCCATCATACCCCTCTTGCTCTACATCACGTCCCC
CATGCTGCTCTGTACCCAACCCTCTTTGCCCCCCGGCCAG
CCAGTGCTGCAGCAGCAGCAGCTCTACAGCTACATCCTCT
TCTTCATCCTATCTTCTCAGGGCAAGACCTTCAGCACCCT
CCAAATCATGGCTCCTGAACATCAAGCTTTTGTCAAAGTA
GTGAAAGCTGAAGAGATTTAGCTACTGGGTGTCCCAGTCT
AGTGATCCACAGTGTTCAACTGTCCTTTTCAACCTCTACC
TTTGAGTGACCTAAACAGGACTGTTCAGGATTGTTTAACT
GAAGACAGAGTATAATCTTGGCGGTCTTTTGAGATTGTAA
TGTAATGAAATTGTATGGTCAGGAGTTAGGTTGAGGTATG
TAACATTGTTTATATATATTCACACAAAGGCGGATGGGCT
TTAAGAGTTGGTTTGTAGGCCAAGACTTGGATCTTACAAG
TAGAGAACCACTGGTATATTGTTTCTTTTTCTATGGTTTG
TCATTATAACTATTATTATTATTTGTCTGATGTGCTTCTT
CTATCCAGAAGCTCGCAGACTGAAGCCATAATCGGGATCT
TTGTTGTGGGCTTTTGGTGTGGTTGGATACAGTTGATATG
AAAAGTCATTTTTGGAGACTTTGTTTTTCCGTGTATCAAG
CCTTTCTGAAAGTTGTAAGGTTTATGAAATAACTCATTGT
ATGAATATGCAAAGATACTCAAGCCTGCTATTTAAGAACC
AGGTAATGATAAACTGACTTACGGTTTGCTGAAGGATTAT
CAAACTATTTAATCGTTTCAGCTCATTCCAATTCTCAGAA
GTCATCGCATCATATTCTGAGCAAAAGGTAACAAACGAAC
AAGATTAATACAATAAAAGCCATACTCAGCACTCAACTGT
GTTAAGCTATTTTTGCTGGTTGGTTGTAAACTAGTATAAA
TGATCTGAAAATAGTAAATGGAAGAGACATCTCATATTGA
TGTCAAGTTTTTATAATGTCACAGGCTGTCAAAACTGCAT
AAGTTACATTTTGGGATTTGAAAATTCCCATCCCTTGATA
TTGAAATTGTGAAATCTTGCACTGAAAAAGAAATGTACAG
TGAGATGCTGTTTTTGCATCTTGTAACAACTGTATGATTG
TAGAATTCTGCAATAATTTGTTTTCTATTTGATTTTAAAT
TATTTTTATTTTTTTGAATAATGTTTCTTTCTGTAAGATT
AGTTAAATGTAAATAAAGGTAACGTAGTGAAACTATGTAA
AATAAAGGTTTGTAACACCTGCTAATAAAAATAATGAAAT
GGGGGGAGGAGGGGGAAGCATATGTGAAAATGATCAGGGT
TGGTACTTTAGTGGACTTGAGTGTCTATGGAATGTGGCAG
AACTTTTGGTGACGTTGCACTGTAAATGGCAGCAGTGACA
TGAGCTTTTTTTAATTCTTCCTTGACGCATCAGCAAATAA
AACTTTGACTTGTAATTCTGGTGTATGATTTTATTTAAAG
CGAGACACATTGCAAGGTCGTCTGTGCCTAAACTAAACCC
TATACTCGTAATAGCCTTCTATTCATAGCAATTCAGAATA
ATGGATTTGAGTTGCACGGCTGTATTGTATTCTAACACAA
GATGGCACTGTTGGAACTTCAATCAGTTTAATAGTGTAGG
GTCATTTTTAAAGGTTTTTACCAGGAATCATAAAACTAAA
ACGGTCTTTCAAAGCTTAACAGGATAGTTCACCCAAGTCT
GAGAATTATGTTGTAATTGTGTCTAATTTCAGCTCCCGTT
GCAACTATTAAAGAAAAAAAAGCTGTAATAAGAAAAAACG
GTTATCATCATACTTTCCTGGCTTACATTACATTAAGATT
TTTTTATGTAATTGTTTTATATGCATTATTCCTACTCTAA
AATATTATGTGTAAAGATTTGAGTCATTGTTTAATTAAAC
AGGTGATAATTATTTTAAAATCAGACATTTTAAGATCAGG
CAATTTTTTTAAGCTTGTTAAAGATCAGGTAACTATGTTA
GGTAATTAGATCAGGTAATTAAGTTAAAATCAGGTAATAA
AGTTTCATTTTTAAAAAAGGGATATCAGGTATATTTATAA
TGTCAATGAGCTTGCATGAGTTTATCTTTCTGTCAACCTT
AATATTAAAACGGGTATTAATGCAAGTTTGGTCTACATGT
GCAGTAAAGATTAATCGCTCAACACAGTGGAAAAAACAAA
ATTGAAAAATATTTATAATGTTAAAAAGGAGTAAAAAATG
TGTTGATTGAAAACTTGAAAACATTGGTCCACTTTCTTGA
TGGGTGTACATTTCTAAAGGGTTCATGCGGTCATGGAAAA
CCTGGAAAAGTCATGGAATTCTGACATGGCATTTTCCAGG
CCTGGAAAAGTAAAAAAAAAAAAAAAAAAAAAACAACAAA
GCTTTTGAAAAATCATTGAAATTAGTTCAACAAATATCTG
TAAACTTCAATATAGGTTAGTTGTCTTTACTTCTTTTCTG
TCTTTGGCCAAAGCATTCATTCATTTTCCTTTCCTCATTT
TCCTTCTCAATTTCAGAGGTGGCACAGCGAGAAAGAACCA
CCGTGATGTGTAAGCATTTTGTAAATAAATCTTTCATACA
ATTGATAAAAAAATAAATTCAATCT

gpatch8 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA gpatch8-001 7025
aberrant processed transcript gpatch8-002 (1) 569
ncRNA gpatch8-003 (1) 421
gpatch8-004 (1) 572
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gpatch8-001 Contained in:
OTHER gpatch8-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053682 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC125884 (1) 2150bp
    GenBank:BC139615 (1) 1996bp
    GenBank:EE716289 (1) 935bp
    GenBank:CT621174 (1) 836bp
    GenBank:CT609718 (1) 820bp
    GenBank:CT640902 (1) 786bp
    GenBank:CT659069 (1) 784bp
    GenBank:DT055306 (1) 768bp
    GenBank:AL725596 (1) 712bp
    GenBank:EB938955 (1) 670bp
    GenBank:EB934594 (1) 662bp
    GenBank:EB885426 (1) 628bp
    GenBank:AW233394 (1) 574bp
    GenBank:CT609719 (1) 522bp
    GenBank:EH546641 (1) 419bp
    GenBank:EH567781 (1) 419bp
    CITATIONS (1)