header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120213-988
Transcript Name: gpatch8-003
Previous Name: dkey-260c8.3-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053685 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053685|OTTDARG00000037547|ZDB-GENE-030131-6966 gpatch8|no_translation DKEY-260C8.3-003 LG_none BX640549.17,CR388062.19 Danio rerio protein_coding NOVEL, 421 bp
AACGCAGGAGACGAGGCGAACAGGAGAGAAAATGGCCGAC
AGATTCTCTAGATTCAACGAAGAACGTGATTTTCAGGGTG
GAAATCACTTTGACCAGTATGAGGAAGGTCAGTTGGAGTT
GGAACAGGCCTCTTTGGACAAGCCCATAGAATCGGATAAC
ATTGGGCACCGGCTCCTTCAGAAACATGGCTGGAAGTTGG
GTCAAGGCCTGGGCAAAACCATGCAGGGTAAGCAAGCACT
CTTCTCTGTCAAACTTAATCTCTCAAACTCTTTCTCTCTA
CTGATATCCACCCAAAAGGCTTCAATGCCTTTTGGTTTGA
TCAGGTGTAAAAATGTTTTCATTCTTTCTGTTCACTTCTC
TCCCTCTCTCTGTTGTTCCAGCACACCATTTATTTTTCTT
ATTTTGTACTGACAAAAAGTT

gpatch8 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA gpatch8-003 421
gpatch8-004 (1) 572
mRNA gpatch8-201 (1) 7025
aberrant processed transcript gpatch8-204 (1) 569
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gpatch8-003 Contained in:

OTHER gpatch8-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053685 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BG305136 (1) 421bp
    CITATIONS (1)