ZFIN ID: ZDB-TSCRIPT-120213-217
Transcript Name: gpatch8-004
Previous Name: dkey-260c8.3-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053683 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053683|OTTDARG00000037547|ZDB-GENE-030131-6966 gpatch8|no_translation DKEY-260C8.3-004 LG_none BX640549.17,CR388062.19 Danio rerio protein_coding NOVEL, 572 bp
AGCCAACTCAAATGGTAAACAATTAAAAATTAGCCTTAGT
TCCAAAGATATTTCAGCACCTGGAATGGCCTTTTAGGGGT
GAGCTGCACATGAAGCTGTGAGAATGGCTAGAGTTTGGTT
CACTGTAGCTTTCTGGTCTCTTGCACTTGAAGGCAGTCTC
TCTAACCCAGCACCCTGTGCTCTAAGCAGGCTGTCCCGCC
CCGAGTTTTCTCTTATATTGAACAATAGTCTAACCTCTGT
ACTATCTCTCTCTTCCTCTCCCCCCCACCTCATAGGACGA
ACTGACCCTGTCCCGATCGTGCTCAAATATGACGTCATGG
GAATGGGGCGAATGGAAATGGAGCTGGACTATGCAGAAGA
TGCCACAGAGAAGCGTCGAGTATTGGAAGTGGAAAAAGAA
GACACTGAGGAACTGCGTCAAAAATACAAGGATTTTGCAG
AGAAAGAAAAAGCTATTGCCAAAGCTTTAGAGGACCTAAG
GGCCAACTTCTACTGTGAACTGTGTGATAAGCAATACCAG
AAGCATCAGGAGTTTGACAATCACATCAACTCCTACGATC
ATGCACACAAGC

gpatch8 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA gpatch8-001 (1) 7025
aberrant processed transcript gpatch8-002 (1) 569
ncRNA gpatch8-003 (1) 421
gpatch8-004 572
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gpatch8-004 Contained in:
OTHER gpatch8-004 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053683 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB975067 (1) 584bp
    CITATIONS (1)