ZFIN ID: ZDB-TSCRIPT-110912-790
Transcript Name: nrp1a-203
Previous Name: nrp1a-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051949 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051949|OTTDARG00000036481|ZDB-GENE-030519-2 nrp1a|OTTDARP00000040820 nrp1a-002 LG_none BX322549.5,CR361556.8,CU210898.6 Danio rerio protein_coding KNOWN, 1977 bp
AGATGTTTGTGTTCCTCACTCCGATTTTGAGACTAAGCAG
AACGCCGGGTTACTATACGCGGAGGCTGAATCTCGTATCC
AAGCCGCACTTTTTTAGCCAAAGTCTAGCGATCTTTCTTG
TCTTTGCGCACAGGATTACTCGTCTATTTCGCGGAACTGC
AACGATTTTTTCCCTTTTCTGTCATTCTTTAACAGGGCGA
AGGAAATGGCAAAGGAGAGAGGATCGGGTCTGGGAGAGCG
CAGAGGAAACCAGAGCTGAATGGCAGGATGCGAGCGACCT
GAAGACGCACAAAACCGCACATTTCTACAGCTCTCAGACC
CTTTTGCGCGCTCTTTCGGTTTCCTTCTTTACACGCGAGA
GGAATTACCCAAATACGACCATCTGAGGATTGTCTCATCG
TTTTTTGCCAAATTTGTGTTATTTTTCCGCACTCCGAACT
CCAGGATTCGAGGATGCATTGTGGATTAGTGTTGATCCTC
TTTACGGGAATCTTTCTCATCGTCAGTGCTCTCAAAAATG
ACAAATGTGGGGACAATATCAGGATCACTAGTGCCAATTA
TCTCACATCGCCCGGCTATCCAGTATCTTACTACCCGTCT
CAGAAATGCATATGGGTGATTACAGCTCCAGGACCCAACC
AGAGGATTTTGATCAACTTCAACCCACACTTTGACCTGGA
AGACCGAGAGTGCAAATATGACTATGTGGAAGTGAGAGAC
GGCGTGGATGAGAACGGGCAGCTGGTGGGCAAATATTGTG
GAAAGATCGCTCCATCTCCGGTGGTCTCGTCGGGAAACCA
GCTCTTCATCAAGTTTGTGTCCGACTACGAGACTCACGGT
GCCGGATTCTCCATCCGCTATGAGATCTTCAAAACGGGTC
CAGAATGTTCCAGGAACTTCACCTCCAGCAGCGGAGTCAT
CAAGTCGCCCGGATTTCCAGAGAAATACCCCAATAATTTG
GACTGCACGTTCATGATCTTTGCTCCTAAGATGTCAGAAA
TCGTTTTAGAGTTCGAGAGTTTTGAGCTGGAGCCAGACAC
GCAGCCGCCCGCCGGAGTCTTCTGCCGATACGACCGCCTG
GAGATTTGGGACGGATTCCCTGGAGTTGGTCCATACATCG
GCAGATACTGCGGACAGAATACTCCAGGACGGATCATATC
CTACACTGGAACTTTGGCCATGACAATCAACACAGACAGC
GCTATTGCTAAAGAAGGATTTTCAGCTAATTTCACTGTGC
TGGAAAGGACGGTTCCTGATGACTTTGACTGCACTGAGCC
TTTGGGTATGGAAACTGGGGAAATCCATTCGGACCAAATC
ATGGCCTCGTCCCAGTACAGCAACAGCTGGTCAGCAGAAC
GATCACGACTCAACAACCCAGAGAACGGCTGGACGCCTTT
GGAGGACACGAATAAAGAGTGGATTCAGGTTGATCTTGGA
TTTCTGCGCTTTGTCTCGGCCATCGGCACACAGGGAGCCA
TTTCTCAGGAGACCAAGAAGAAATATTACGTGAAGGAATA
TAAGGTGGACGTGAGCTCCAATGGTGAAGACTGGATCACT
ATTAAGGATGGCCCAAAACAGAAGCTTTTCCAGGGTAACA
CCAACCCTACTGATGTGGTGAAAGCCAAGTTTCCAAAGCC
CACGCTGACCCGATACCTGCGGATCCGACCCATTAACTGG
GAAACTGGCATCGCACTGCGGTTCGAGGTCTACGGATGCA
AGATCTCAGGTTGGTGCCAAACTTTTCTCTTTAATACTTA
TGTTTATTAAAAAATACAACGTTGCATAGAGTACGACACA
AGTGTACAAGTTGATTTATTGGATTTTTTTATTTATTTAA
ATTTTAGGTTTTTTTTTGCATGTTAGTCCATCAATTTCTA
GCTAGCATAGTGGTTGTAAATACAAACAGAAAACATCATT
TAAACACAGAGGAAGCAAAAAAATAAAAATATATAAATAA
ATATACAAATGTACAAA

nrp1a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA nrp1a-201 (1) 3875
nrp1a-202 (1) 3644
nrp1a-203 1977
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nrp1a-203 Contained in:
OTHER nrp1a-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000051949 (1)
  • Ensembl_Trans:ENSDART00000164904 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC093101 (1) 1991bp
    CITATIONS (2)