Transcript

nrp1a-201

ID
ZDB-TSCRIPT-110912-194
Name
nrp1a-201
Previous Names
  • nrp1a-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051947 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051947|OTTDARG00000036481|ZDB-GENE-030519-2 nrp1a|OTTDARP00000040818 nrp1a-003 LG_none BX322549.5,CR361556.8,CU210898.6 Danio rerio protein_coding KNOWN, 3875 bp
CTCGTATCCAAGCCGCACTTTTTTAGCCAAAGTCTAGCGA
TCTTTCTTGTCTTTGCGCACAGGATTACTCGTCTATTTCG
CGGAACTGCAACGATTTTTTCCCTTTTCTGTCATTCTTTA
ACAGGGCGAAGGAAATGGCAAAGGAGAGAGGATCGGGTCT
GGGAGAGCGCAGAGGAAACCAGAGCTGAATGGCAGGATGC
GAGCGACCTGAAGACGCACAAAACCGCACATTTCTACAGC
TCTCAGACCCTTTTGCGCGCTCTTTCGGTTTCCTTCTTTA
CACGCGAGAGGAATTACCCAAATACGACCATCTGAGGATT
GTCTCATCGTTTTTTGCCAAATTTGTGTTATTTTTCCGCA
CTCCGAACTCCAGGATTCGAGGATGCATTGTGGATTAGTG
TTGATCCTCTTTACGGGAATCTTTCTCATCGTCAGTGCTC
TCAAAAATGACAAATGTGGGGACAATATCAGGATCACTAG
TGCCAATTATCTCACATCGCCCGGCTATCCAGTATCTTAC
TACCCGTCTCAGAAATGCATATGGGTGATTACAGCTCCAG
GACCCAACCAGAGGATTTTGATCAACTTCAACCCACACTT
TGACCTGGAAGACCGAGAGTGCAAATATGACTATGTGGAA
GTGAGAGACGGCGTGGATGAGAACGGGCAGCTGGTGGGCA
AATATTGTGGAAAGATCGCTCCATCTCCGGTGGTCTCGTC
GGGAAACCAGCTCTTCATCAAGTTTGTGTCCGACTACGAG
ACTCACGGTGCCGGATTCTCCATCCGCTATGAGATCTTCA
AAACGGGTCCAGAATGTTCCAGGAACTTCACCTCCAGCAG
CGGAGTCATCAAGTCGCCCGGATTTCCAGAGAAATACCCC
AATAATTTGGACTGCACGTTCATGATCTTTGCTCCTAAGA
TGTCAGAAATCGTTTTAGAGTTCGAGAGTTTTGAGCTGGA
GCCAGACACGCAGCCGCCCGCCGGAGTCTTCTGCCGATAC
GACCGCCTGGAGATTTGGGACGGATTCCCTGGAGTTGGTC
CATACATCGGCAGATACTGCGGACAGAATACTCCAGGACG
GATCATATCCTACACTGGAACTTTGGCCATGACAATCAAC
ACAGACAGCGCTATTGCTAAAGAAGGATTTTCAGCTAATT
TCACTGTGCTGGAAAGGACGGTTCCTGATGACTTTGACTG
CACTGAGCCTTTGGGTATGGAAACTGGGGAAATCCATTCG
GACCAAATCATGGCCTCGTCCCAGTACAGCAACAGCTGGT
CAGCAGAACGATCACGACTCAACAACCCAGAGAACGGCTG
GACGCCTTTGGAGGACACGAATAAAGAGTGGATTCAGGTT
GATCTTGGATTTCTGCGCTTTGTCTCGGCCATCGGCACAC
AGGGAGCCATTTCTCAGGAGACCAAGAAGAAATATTACGT
GAAGGAATATAAGGTGGACGTGAGCTCCAATGGTGAAGAC
TGGATCACTATTAAGGATGGCCCAAAACAGAAGCTTTTCC
AGGGTAACACCAACCCTACTGATGTGGTGAAAGCCAAGTT
TCCAAAGCCCACGCTGACCCGATACCTGCGGATCCGACCC
ATTAACTGGGAAACTGGCATCGCACTGCGGTTCGAGGTCT
ACGGATGCAAGATCTCAGAGTATCCGTGCTCAGGAATGCT
GGGAATGGTTTCAGGCCTGATCACAGACTCTCAGATCACC
GTCTCGTCCCACATCGAGCGTACCTGGGTTTCAGAAAACG
CTCGTCTGATGACCAGCCGTTCAGGATGGATGTTACTGCC
ACAGTCACAACCGTATGCAGACGAATGGCTGCAGATAGAT
CTGGCCGAAGAAAAACTAGTCAAAGGTTTGATCATCCAGG
GAGGCAAACACCGAGATAACAAGGTGTTCATGAAGAAGTT
TCGTCTGGGATACAGCAACAACGGATCCGATTGGAAATTG
GTGATGGATGCTACCGGCAACAAGCCCAAGATTTTTGAGG
GGAATTTGAACTATGACACCCCAGCGTTGAGGACAATGGA
GCCAGTGTTGACACGCTTTGTTAGGATTTACCCAGACAGA
GGCACTCCTGCTGGGATGGGACTCAGACTGGAACTTTTGG
GATGTGAAATGGAAGTGCCTACAGTGCCGCCTACTACACC
CGCAGCCTCCACCACACCGTCAGACGAGTGTGACGATGAC
CAGGCCAACTGCCATAGTGGAACAGGTGGAACCACTGCGA
CAGAGACGATCAGGGAGATGAGCACCATTCCAGCATTCCT
GTGGTTTGCTTGTGACTTCGGCTGGGCAAATGATCCTTCG
TTCTGCGGCTGGATCTCCGAGGACAGCGGTTTCAGGTGGC
AGATTCAGTCCAGTGGCACCCCGACTCTAAACACCGGCCC
AAACATGGACCACACAGGCGGATCAGGGAACTTCATCTAC
ACGCTGGCGACCGGAGCTCAGGAGACAGAAGTGGCCCGGT
TAGTGAGTCCGTCGGTGTCGGGCCAGGACTCAGACCTCTG
CCTGTCTTTCTGGTACCACATGTTTGGCTCTCACATCGGC
ACGCTGCACATTAAACAGCGCAGAGAGACCAGTCAGGGCT
CGGCTGATGTGCTGCTGTGGACCGTCAGCGGACATCAGGG
CAACCGCTGGAGGGAGGGACGCGTCCTCATACCACACTCC
AACAAACCCTACCAGGTAATAATTGAAAGTGTGGTCGAGA
GGAAGAGTTGGGGAGACATCGCTGTAGACGACATCAAAAT
CTTAGACAATGTGAACATGGCCGACTGCAAGGACCCAGAT
GTCCCAGCAGAGCCGATACAGCCAGAAGACAATTTCAATG
AAATCATGGTGGACATCACCGATTTCCCAGATATCGTGGA
GAACCCAGATATCGGCGGAGCTGGAAACATGCTGAAAACC
CTGGACCCCATCCTCATTACTATCATCGCCATGAGTGCGC
TTGGTGTTTTCCTGGGCGCCATCTGTGGCGTGGTGCTGTA
CTGCGCCTGCTCTCATAGCGGCATGTCAGACAGGAACTTA
TCAGCCCTGGAGAACTATAATTTTGAGCTGGTGGACGGCG
TCAAGTTAAAGAAGGACAAGCTCAACTCACAGAACTCGTA
CTCGGAAGCGTGAGGCGCCGACCAATAAGAGGGAATCTCT
CCTCAGGGGGGGCGGGGCTACATGGACTGCCGATGCCATC
CGATTGGAGGAGGACAAGGCTCTGTGGTTCAGTGAACCAA
TCGGAGGAGGACTGGGACTGAGCCATGCTTTTCTCAGGAG
CTGCAGTGAATAGAACCCACCAGTAGGGGGACACTGTGTA
CAAAACATTGAAAAAAAAACACACGAATATGTACAGATGA
TTGAAATTATTATTTTATTGTTTTGTATTATTTTTTGGTT
GATCATTTTTACAATCGGATGCTGGTGTTGAGACCAATAT
ATAATAATGTTATAAAGTATTTATCTTTTCTTTCTTTTCT
AGGAGGAATTTATTTTTATTTTTAAAAAAAGAGATTGTTT
TGCGCTTTAAGGAGATGTGTAAACAAAAACAAACAAAAAA
ACCCAAATGAACCATATATACGGCCAAGGGAAGGTAATTA
GGATCAAAGGGGTGGAATATCATCCAGCCCTGTTGCATTC
TGGGTATGGTTCGGTCAGTGCCTTTGGTACATCTTTTTTG
GCCTCCTCTGTTGTTTTATGGCGTTCTCAACCCTTTAGTT
CTTTAAAACAAAACAAGGCTGAAACTGCAAAACGAATCCC
GGGGAAATTCATAGCGCTTTAATGTCGAAATCATGCATAT
TGTACATACGTTTTAATATATTTTAATGCCCTTTTCAAAG
AAACAAGTAAAAGGACAAAAAAGAGAGCTGCAGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations