ZFIN ID: ZDB-TSCRIPT-110912-194
Transcript Name: nrp1a-201
Previous Name: nrp1a-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051947 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051947|OTTDARG00000036481|ZDB-GENE-030519-2 nrp1a|OTTDARP00000040818 nrp1a-003 LG_none BX322549.5,CR361556.8,CU210898.6 Danio rerio protein_coding KNOWN, 3875 bp
CTCGTATCCAAGCCGCACTTTTTTAGCCAAAGTCTAGCGA
TCTTTCTTGTCTTTGCGCACAGGATTACTCGTCTATTTCG
CGGAACTGCAACGATTTTTTCCCTTTTCTGTCATTCTTTA
ACAGGGCGAAGGAAATGGCAAAGGAGAGAGGATCGGGTCT
GGGAGAGCGCAGAGGAAACCAGAGCTGAATGGCAGGATGC
GAGCGACCTGAAGACGCACAAAACCGCACATTTCTACAGC
TCTCAGACCCTTTTGCGCGCTCTTTCGGTTTCCTTCTTTA
CACGCGAGAGGAATTACCCAAATACGACCATCTGAGGATT
GTCTCATCGTTTTTTGCCAAATTTGTGTTATTTTTCCGCA
CTCCGAACTCCAGGATTCGAGGATGCATTGTGGATTAGTG
TTGATCCTCTTTACGGGAATCTTTCTCATCGTCAGTGCTC
TCAAAAATGACAAATGTGGGGACAATATCAGGATCACTAG
TGCCAATTATCTCACATCGCCCGGCTATCCAGTATCTTAC
TACCCGTCTCAGAAATGCATATGGGTGATTACAGCTCCAG
GACCCAACCAGAGGATTTTGATCAACTTCAACCCACACTT
TGACCTGGAAGACCGAGAGTGCAAATATGACTATGTGGAA
GTGAGAGACGGCGTGGATGAGAACGGGCAGCTGGTGGGCA
AATATTGTGGAAAGATCGCTCCATCTCCGGTGGTCTCGTC
GGGAAACCAGCTCTTCATCAAGTTTGTGTCCGACTACGAG
ACTCACGGTGCCGGATTCTCCATCCGCTATGAGATCTTCA
AAACGGGTCCAGAATGTTCCAGGAACTTCACCTCCAGCAG
CGGAGTCATCAAGTCGCCCGGATTTCCAGAGAAATACCCC
AATAATTTGGACTGCACGTTCATGATCTTTGCTCCTAAGA
TGTCAGAAATCGTTTTAGAGTTCGAGAGTTTTGAGCTGGA
GCCAGACACGCAGCCGCCCGCCGGAGTCTTCTGCCGATAC
GACCGCCTGGAGATTTGGGACGGATTCCCTGGAGTTGGTC
CATACATCGGCAGATACTGCGGACAGAATACTCCAGGACG
GATCATATCCTACACTGGAACTTTGGCCATGACAATCAAC
ACAGACAGCGCTATTGCTAAAGAAGGATTTTCAGCTAATT
TCACTGTGCTGGAAAGGACGGTTCCTGATGACTTTGACTG
CACTGAGCCTTTGGGTATGGAAACTGGGGAAATCCATTCG
GACCAAATCATGGCCTCGTCCCAGTACAGCAACAGCTGGT
CAGCAGAACGATCACGACTCAACAACCCAGAGAACGGCTG
GACGCCTTTGGAGGACACGAATAAAGAGTGGATTCAGGTT
GATCTTGGATTTCTGCGCTTTGTCTCGGCCATCGGCACAC
AGGGAGCCATTTCTCAGGAGACCAAGAAGAAATATTACGT
GAAGGAATATAAGGTGGACGTGAGCTCCAATGGTGAAGAC
TGGATCACTATTAAGGATGGCCCAAAACAGAAGCTTTTCC
AGGGTAACACCAACCCTACTGATGTGGTGAAAGCCAAGTT
TCCAAAGCCCACGCTGACCCGATACCTGCGGATCCGACCC
ATTAACTGGGAAACTGGCATCGCACTGCGGTTCGAGGTCT
ACGGATGCAAGATCTCAGAGTATCCGTGCTCAGGAATGCT
GGGAATGGTTTCAGGCCTGATCACAGACTCTCAGATCACC
GTCTCGTCCCACATCGAGCGTACCTGGGTTTCAGAAAACG
CTCGTCTGATGACCAGCCGTTCAGGATGGATGTTACTGCC
ACAGTCACAACCGTATGCAGACGAATGGCTGCAGATAGAT
CTGGCCGAAGAAAAACTAGTCAAAGGTTTGATCATCCAGG
GAGGCAAACACCGAGATAACAAGGTGTTCATGAAGAAGTT
TCGTCTGGGATACAGCAACAACGGATCCGATTGGAAATTG
GTGATGGATGCTACCGGCAACAAGCCCAAGATTTTTGAGG
GGAATTTGAACTATGACACCCCAGCGTTGAGGACAATGGA
GCCAGTGTTGACACGCTTTGTTAGGATTTACCCAGACAGA
GGCACTCCTGCTGGGATGGGACTCAGACTGGAACTTTTGG
GATGTGAAATGGAAGTGCCTACAGTGCCGCCTACTACACC
CGCAGCCTCCACCACACCGTCAGACGAGTGTGACGATGAC
CAGGCCAACTGCCATAGTGGAACAGGTGGAACCACTGCGA
CAGAGACGATCAGGGAGATGAGCACCATTCCAGCATTCCT
GTGGTTTGCTTGTGACTTCGGCTGGGCAAATGATCCTTCG
TTCTGCGGCTGGATCTCCGAGGACAGCGGTTTCAGGTGGC
AGATTCAGTCCAGTGGCACCCCGACTCTAAACACCGGCCC
AAACATGGACCACACAGGCGGATCAGGGAACTTCATCTAC
ACGCTGGCGACCGGAGCTCAGGAGACAGAAGTGGCCCGGT
TAGTGAGTCCGTCGGTGTCGGGCCAGGACTCAGACCTCTG
CCTGTCTTTCTGGTACCACATGTTTGGCTCTCACATCGGC
ACGCTGCACATTAAACAGCGCAGAGAGACCAGTCAGGGCT
CGGCTGATGTGCTGCTGTGGACCGTCAGCGGACATCAGGG
CAACCGCTGGAGGGAGGGACGCGTCCTCATACCACACTCC
AACAAACCCTACCAGGTAATAATTGAAAGTGTGGTCGAGA
GGAAGAGTTGGGGAGACATCGCTGTAGACGACATCAAAAT
CTTAGACAATGTGAACATGGCCGACTGCAAGGACCCAGAT
GTCCCAGCAGAGCCGATACAGCCAGAAGACAATTTCAATG
AAATCATGGTGGACATCACCGATTTCCCAGATATCGTGGA
GAACCCAGATATCGGCGGAGCTGGAAACATGCTGAAAACC
CTGGACCCCATCCTCATTACTATCATCGCCATGAGTGCGC
TTGGTGTTTTCCTGGGCGCCATCTGTGGCGTGGTGCTGTA
CTGCGCCTGCTCTCATAGCGGCATGTCAGACAGGAACTTA
TCAGCCCTGGAGAACTATAATTTTGAGCTGGTGGACGGCG
TCAAGTTAAAGAAGGACAAGCTCAACTCACAGAACTCGTA
CTCGGAAGCGTGAGGCGCCGACCAATAAGAGGGAATCTCT
CCTCAGGGGGGGCGGGGCTACATGGACTGCCGATGCCATC
CGATTGGAGGAGGACAAGGCTCTGTGGTTCAGTGAACCAA
TCGGAGGAGGACTGGGACTGAGCCATGCTTTTCTCAGGAG
CTGCAGTGAATAGAACCCACCAGTAGGGGGACACTGTGTA
CAAAACATTGAAAAAAAAACACACGAATATGTACAGATGA
TTGAAATTATTATTTTATTGTTTTGTATTATTTTTTGGTT
GATCATTTTTACAATCGGATGCTGGTGTTGAGACCAATAT
ATAATAATGTTATAAAGTATTTATCTTTTCTTTCTTTTCT
AGGAGGAATTTATTTTTATTTTTAAAAAAAGAGATTGTTT
TGCGCTTTAAGGAGATGTGTAAACAAAAACAAACAAAAAA
ACCCAAATGAACCATATATACGGCCAAGGGAAGGTAATTA
GGATCAAAGGGGTGGAATATCATCCAGCCCTGTTGCATTC
TGGGTATGGTTCGGTCAGTGCCTTTGGTACATCTTTTTTG
GCCTCCTCTGTTGTTTTATGGCGTTCTCAACCCTTTAGTT
CTTTAAAACAAAACAAGGCTGAAACTGCAAAACGAATCCC
GGGGAAATTCATAGCGCTTTAATGTCGAAATCATGCATAT
TGTACATACGTTTTAATATATTTTAATGCCCTTTTCAAAG
AAACAAGTAAAAGGACAAAAAAGAGAGCTGCAGTA

nrp1a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA nrp1a-201 3875
nrp1a-202 (1) 3644
nrp1a-203 (1) 1977
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nrp1a-201 Contained in:
OTHER nrp1a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000051947 (1)
  • Ensembl_Trans:ENSDART00000159212 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC115224 (1) 3901bp
    GenBank:BC163888 (1) 2878bp
    CITATIONS (2)