ZFIN ID: ZDB-TSCRIPT-110912-494
Transcript Name: nrp1a-202
Previous Name: ottdart00000051948

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051948 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051948|OTTDARG00000036481|ZDB-GENE-030519-2 nrp1a|OTTDARP00000040819 nrp1a-001 LG_none BX322549.5,CR361556.8,CU210898.6 Danio rerio protein_coding KNOWN, 3644 bp
ATGTTTGTGTTCCTCACTCCGATTTTGAGACTAAGCAGAA
CGCCGGGTTACTATACGCGGAGGCTGAATCTCGTATCCAA
GCCGCACTTTTTTAGCCAAAGTCTAGCGATCTTTCTTGTC
TTTGCGCACAGGATTACTCGTCTATTTCGCGGAACTGCAA
CGATTTTTTCCCTTTTCTGTCATTCTTTAACAGGGCGAAG
GAAATGGCAAAGGAGAGAGGATCGGGTCTGGGAGAGCGCA
GAGGAAACCAGAGCTGAATGGCAGGATGCGAGCGACCTGA
AGACGCACAAAACCGCACATTTCTACAGCTCTCAGACCCT
TTTGCGCGCTCTTTCGGTTTCCTTCTTTACACGCGAGAGG
AATTACCCAAATACGACCATCTGAGGATTGTCTCATCGTT
TTTTGCCAAATTTGTGTTATTTTTCCGCACTCCGAACTCC
AGGATTCGAGGATGCATTGTGGATTAGTGTTGATCCTCTT
TACGGGAATCTTTCTCATCGTCAGTGCTCTCAAAAATGAC
AAATGTGGGGACAATATCAGGATCACTAGTGCCAATTATC
TCACATCGCCCGGCTATCCAGTATCTTACTACCCGTCTCA
GAAATGCATATGGGTGATTACAGCTCCAGGACCCAACCAG
AGGATTTTGATCAACTTCAACCCACACTTTGACCTGGAAG
ACCGAGAGTGCAAATATGACTATGTGGAAGTGAGAGACGG
CGTGGATGAGAACGGGCAGCTGGTGGGCAAATATTGTGGA
AAGATCGCTCCATCTCCGGTGGTCTCGTCGGGAAACCAGC
TCTTCATCAAGTTTGTGTCCGACTACGAGACTCACGGTGC
CGGATTCTCCATCCGCTATGAGATCTTCAAAACGGGTCCA
GAATGTTCCAGGAACTTCACCTCCAGCAGCGGAGTCATCA
AGTCGCCCGGATTTCCAGAGAAATACCCCAATAATTTGGA
CTGCACGTTCATGATCTTTGCTCCTAAGATGTCAGAAATC
GTTTTAGAGTTCGAGAGTTTTGAGCTGGAGCCAGACACGC
AGCCGCCCGCCGGAGTCTTCTGCCGATACGACCGCCTGGA
GATTTGGGACGGATTCCCTGGAGTTGGTCCATACATCGGC
AGATACTGCGGACAGAATACTCCAGGACGGATCATATCCT
ACACTGGAACTTTGGCCATGACAATCAACACAGACAGCGC
TATTGCTAAAGAAGGATTTTCAGCTAATTTCACTGTGCTG
GAAAGGACGGTTCCTGATGACTTTGACTGCACTGAGCCTT
TGGGTATGGAAACTGGGGAAATCCATTCGGACCAAATCAT
GGCCTCGTCCCAGTACAGCAACAGCTGGTCAGCAGAACGA
TCACGACTCAACAACCCAGAGAACGGCTGGACGCCTTTGG
AGGACACGAATAAAGAGTGGATTCAGGTTGATCTTGGATT
TCTGCGCTTTGTCTCGGCCATCGGCACACAGGGAGCCATT
TCTCAGGAGACCAAGAAGAAATATTACGTGAAGGAATATA
AGGTGGACGTGAGCTCCAATGGTGAAGACTGGATCACTAT
TAAGGATGGCCCAAAACAGAAGCTTTTCCAGGGTAACACC
AACCCTACTGATGTGGTGAAAGCCAAGTTTCCAAAGCCCA
CGCTGACCCGATACCTGCGGATCCGACCCATTAACTGGGA
AACTGGCATCGCACTGCGGTTCGAGGTCTACGGATGCAAG
ATCTCAGAGTATCCGTGCTCAGGAATGCTGGGAATGGTTT
CAGGCCTGATCACAGACTCTCAGATCACCGTCTCGTCCCA
CATCGAGCGTACCTGGGTTTCAGAAAACGCTCGTCTGATG
ACCAGCCGTTCAGGATGGATGTTACTGCCACAGTCACAAC
CGTATGCAGACGAATGGCTGCAGATAGATCTGGCCGAAGA
AAAACTAGTCAAAGGTTTGATCATCCAGGGAGGCAAACAC
CGAGATAACAAGGTGTTCATGAAGAAGTTTCGTCTGGGAT
ACAGCAACAACGGATCCGATTGGAAATTGGTGATGGATGC
TACCGGCAACAAGCCCAAGATTTTTGAGGGGAATTTGAAC
TATGACACCCCAGCGTTGAGGACAATGGAGCCAGTGTTGA
CACGCTTTGTTAGGATTTACCCAGACAGAGGCACTCCTGC
TGGGATGGGACTCAGACTGGAACTTTTGGGATGTGAAATG
GAAGTGCCTACAGTGCCGCCTACTACACCCGCAGCCTCCA
CCACACCGTCAGACGAGTGTGACGATGACCAGGCCAACTG
CCATAGTGGAACAGGTGATGACTACGACCAGACAGGTGGA
ACCACTGCGACAGAGACGATCAGGGAGATGAGCACCATTC
CAGCATTCCTGTGGTTTGCTTGTGACTTCGGCTGGGCAAA
TGATCCTTCGTTCTGCGGCTGGATCTCCGAGGACAGCGGT
TTCAGGTGGCAGATTCAGTCCAGTGGCACCCCGACTCTAA
ACACCGGCCCAAACATGGACCACACAGGCGGATCAGGGAA
CTTCATCTACACGCTGGCGACCGGAGCTCAGGAGACAGAA
GTGGCCCGGTTAGTGAGTCCGTCGGTGTCGGGCCAGGACT
CAGACCTCTGCCTGTCTTTCTGGTACCACATGTTTGGCTC
TCACATCGGCACGCTGCACATTAAACAGCGCAGAGAGACC
AGTCAGGGCTCGGCTGATGTGCTGCTGTGGACCGTCAGCG
GACATCAGGGCAACCGCTGGAGGGAGGGACGCGTCCTCAT
ACCACACTCCAACAAACCCTACCAGGTAATAATTGAAAGT
GTGGTCGAGAGGAAGAGTTGGGGAGACATCGCTGTAGACG
ACATCAAAATCTTAGACAATGTGAACATGGCCGACTGCAA
GGACCCAGATGTCCCAGCAGAGCCGATACAGCCAGAAGAC
AATTTCAATGAAATCATGGTGGACATCACCGATTTCCCAG
ATATCGTGGAGAACCCAGATATCGGCGGAGCTGGAAACAT
GCTGAAAACCCTGGACCCCATCCTCATTACTATCATCGCC
ATGAGTGCGCTTGGTGTTTTCCTGGGCGCCATCTGTGGCG
TGGTGCTGTACTGCGCCTGCTCTCATAGCGGCATGTCAGA
CAGGAACTTATCAGCCCTGGAGAACTATAATTTTGAGCTG
GTGGACGGCGTCAAGTTAAAGAAGGACAAGCTCAACTCAC
AGAACTCGTACTCGGAAGCGTGAGGCGCCGACCAATAAGA
GGGAATCTCTCCTCAGGGGGGGCGGGGCTACATGGACTGC
CGATGCCATCCGATTGGAGGAGGACAAGGCTCTGTGGTTC
AGTGAACCAATCGGAGGAGGACTGGGACTGAGCCATGCTT
TTCTCAGGAGCTGCAGTGAATAGAACCCACCAGTAGGGGG
ACACTGTGTACAAAACATTGAAAAAAAAACACACGAATAT
GTACAGATGATTGAAATTATTATTTTATTGTTTTGTATTA
TTTTTTGGTTGATCATTTTTACAATCGGATGCTGGTGTTG
AGACCAATATATAATAATGTTATAAAGTATTTATCTTTTC
TTTCTTTTCTAGGAGGAATTTATTTTTATTTTTAAAAAAA
GAGATTGTTTTGCGCTTTAAGGAGATGTGTAAACAAAAAC
AAAC

nrp1a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA nrp1a-201 (1) 3875
nrp1a-202 3644
nrp1a-203 (1) 1977
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nrp1a-202 Contained in:
OTHER nrp1a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000051948 (1)
  • Ensembl_Trans:ENSDART00000159267 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY351910 (1) 3299bp
    GenBank:AY064213 (1) 3174bp
    GenBank:CO915289 (1) 826bp
    GenBank:EB843247 (1) 531bp
    CITATIONS (2)