Transcript

erbb3a-002

ID
ZDB-TSCRIPT-110325-975
Name
erbb3a-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000047630 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047630|OTTDARG00000033795|ZDB-GENE-030916-3 erbb3a|no_translation erbb3a-002 LG_none AL953886.9,FP236160.3,FP017252.5 Danio rerio protein_coding KNOWN, 532 bp
GTATTTCGATGCCTTTCAGACTTGTTTTGTGTTATATTAT
GTTTGTTTATGAGCTGACGTGTAGCGACTGACGGATTTTA
TAGTCGAGCCAGGCTATAAACACATCGAAATGGACTACTT
CATTTATATTATTGCTTTATCTATATAACATTTCATATTT
GAAACATTTTGGGGAGCAAATAGGAAAGAAAACAACAAGC
GAACAAACGTATAAGGATTTCTGTCAGACAAGCCCAAGCG
AAGGGAGCATCATCTCTTCAGCGATCCTTTCGCCATGGAT
ATTTAACTGGCACCTGAGCCTGACGGATTGACTTCACATC
TATAATATCCTGATGAAAATTATGAAGATGAAATCAGCTA
TGCTCCAGATGATCGCGATGTGCCTAGCGCTCCGTTCACC
TGCGCGCGCTCAGACGCAGGAAGGGAAACCTGAAGTGTAC
TATTGGTCTATCCTAAACACTCTGTACAGAATAACGAGAG
AAGAACAAAAATGCCTTCCAAAACTCCCGCCTGATGAAGT
GACGTCACACTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations