ZFIN ID: ZDB-TSCRIPT-110325-68
Transcript Name: erbb3a-204
Previous Name: erbb3a-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047632 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047632|OTTDARG00000033795|ZDB-GENE-030916-3 erbb3a|OTTDARP00000037406 erbb3a-004 LG_none AL953886.9,FP236160.3,FP017252.5 Danio rerio protein_coding KNOWN, 412 bp
GTGCTCCTCTGAGGGATGCTGGGGTCCGGGACCCGATCAG
TGTTTGTCCTGCAAGAACTTCAGAAGAGGAGGAACATGTG
TACCAGACTGCAACTTCATGTCCGGTGAGCAGCGTGAGTT
CGCAGGCCCTAAAAACGAGTGTATGGCTTGTCATCAGGAG
TGTGCGCTTCAAGACAGCGGAGACACCTGCAAAGGACCGG
GCTCTGATGAGTGCAAAGCGTGTGCTCATCTGCAGGACGG
CCCGTACTGTGTGTCCTCCTGTCCAGAGGGAGTTCAGGGG
GAAAATGGACTCATCATTTATAAGTTCCCTAATAGACAAA
ACAAATGCCAACCTTGTCATGCCAACTGCACCTTGGGGTG
TTTGGGTCCGGGTCAGAATGACTGTGTGGACTCGTCCAGG
TCCAGCGCTGGG

erbb3a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA erbb3a-001 (1) 3918
erbb3a-203 (1)    Ensembl 6282
erbb3a-204 412
ncRNA erbb3a-002 (1) 532
erbb3a-005 (1) 519
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
erbb3a-204 Contained in:
[Fosmid] CH1073-215O18 (1)

Genome Resources: Vega_Trans:OTTDART00000047632 (1),  Ensembl_Trans:ENSDART00000149285 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CD604265 (1) 418 nt
CITATIONS (2)