Transcript

erbb3a-203

ID
ZDB-TSCRIPT-110325-67
Name
erbb3a-203
Previous Names
  • ottdart00000047629
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000047629 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047629|OTTDARG00000033795|ZDB-GENE-030916-3 erbb3a|OTTDARP00000037404 erbb3a-001 LG_none AL953886.9,FP236160.3,FP017252.5 Danio rerio protein_coding KNOWN, 6282 bp
TCCTGCGCGCGACAGGCTTTACACTTTCACAAACATCCTT
AGCCTCGTGTGTATTTCGATGCCTTTCAGACTTGTTTTGT
GTTATATTATGTTTGTTTATGAGCTGACGTGTAGCGACTG
ACGGATTTTATAGTCGAGCCAGGCTATAAACACATCGAAA
TGGACTACTTCATTTATATTATTGCTTTATCTATATAACA
TTTCATATTTGAAACATTTTGGGGAGCAAATAGGAAAGAA
AACAACAAGCGAACAAACGTATAAGGATTTCTGTCAGACA
AGCCCAAGCGAAGGGAGCATCATCTCTTCAGCGATCCTTT
CGCCATGGATATTTAACTGGCACCTGAGCCTGACGGATTG
ACTTCACATCTATAATATCCTGATGAAAATTATGAAGATG
AAATCAGCTATGCTCCAGATGATCGCGATGTGCCTAGCGC
TCCGTTCACCTGCGCGCGCTCAGACGCAGGAAGGGAAACC
TGAAGTTGGAGTGTGTACAGGCACTCAGAATTTGCTGAGT
GTGACGGGAAGCTCTGAGGTCCAATACAAACTCATGAAGG
AAATGTACACAGGTTGCCAGATTGTCATAGGAAACCTGGA
GATCACACAGATGGAGCACAACCGCGATTTCTCATTCCTA
CAGTCTATCCGTGAGGTAACCGGCTACATCCTCATCGCTA
TAAACCAGTTCAGACGTTTACCGCTGGAGCAGCTGCGGGT
TATACGGGGAACGTCTCTGTATGAAGATAAATTCGCCCTC
GCTGTCCTTGTCAACTATCAGAAAGACGGAGTGTATGGAC
TGAGGGAGCTGGGCCTCACACACTTGACAGAGATCCTGGA
GGGTGGCGTGCAGATCATCCAGAATAAATTCTTGAGCTAC
GCACCGCAGATTAACTGGCAAGACATTGTGAAAAACAGTG
GAGCAGAAGTCATCATACAAGACAATGGACCAGAAGTTCC
CTGTCATGAGTCTTGCGGGGGTCCATGTTGGGGTCCAGGA
AATGACACCTGTCAAATCTTGACTAAGACAGTGTGCGCAC
TGCAATGTAACGTGCGCTGTTTTGGACGCAGCCCGAGTGA
GTGTTGCCATAATGAGTGTGCCGGCGGCTGCACCGGACCC
CTCGACACCGACTGCTTTGCCTGCAGAAACTTCAACAACT
CGGGCTCGTGTGTGTCGCAGTGTCCAAGGGCTGATATTTA
CAACAAAGTGACATTCAAAATGGAGCCCAATCCTAACGCC
AAATACCAGTTTGGCTCCATGTGTGTGTCACATTGCCCTC
CTAATTTTGTTGTAGATGGCAGTTCGTGTGTTAGCAGCTG
TCCAGCAGACAAGATGGAGGTGGATAAAACAGGGGTGAAA
AGGTGTGAGAAGTGTGAAGGCCTCTGTCCTAAAGCCTGTG
TTGGCACCGGCACCGGCACCGCCTCCAGACAGACAGTAGA
TTCCCAAAACATCGACAGCTTCATAAACTGCACCAAGATT
CAGGGCAGCCTGCACTTCCTTGTCACAGGAATTAAAGGAG
ACAGTTATAATAACATCAGTGCTCTGGATCCAAAGAAACT
TAAGATCTTCAACACTGTCCGAGAGATCACAGACATTCTG
AGTATTCAATCTTGGCCTGAAGAGCTGGAAGATCTTTCTG
TTTTCTCCAATCTAGCAACAATACAGGGAAGAACACTGTA
TAGGGGTTATTCTCTTTTGGTAATGAAGATCCCAACGCTG
AAGTCTCTGGGCCTTCGCTCTCTGAAGCGAATCAGTGATG
GAGGGATCTACATCACAGGAAACACACAGCTCTGTTATCA
TCACACTGTGAACTGGACGCGTTTGTTCGGCAGCGGTCCG
CGAGCCCTGCGCCGCCAAAAATCACTGGACATCAAGGAGA
ATCGCCCTCAGGAGCAATGCAGGATGCTGGGGTCCGGGAC
CCGATCAGTGTTTGTCCTGCAAGAACTTCAGAAGAGGAGG
AACATGTGTACCAGACTGCAACTTCATGTCCGGGGCTCTG
ATGAGTGCAAAGCGTGTGCTCATCTGCAGGACGGCCCGTA
CTGTGTGTCCTCCTGTCCAGAGGGAGTTCAGGGGGAAAAT
GGACTCATCATTTATAAGTTCCCTAATAGACAAAACAAAT
GCCAACCTTGTCATGCCAACTGCACCTTGGGCTCAGCTCA
TTATGGTGTTAATATTGTGCGTTACAGGCTGCCGGTCACC
GCCATCGTGCTGAGCGTCATATTCTGTGTCCTGCTCGCGT
TTTCGGTGTTTGTGCTGAGTGTGCTTTACCGCAGGAGTCT
CTCCATCCGCAGAAAACGAGCCATGAGGAGATACCTGCAG
AGCGGAGAGAGCTTTGAACCGCTGGAACCCGGAGAGAAAG
GTGTGAAAGTTCATGCTCGGATTCTGAGAACTTCTGAATT
GAAGAAGATCAAGCTTCTGGGCTCTGGAGTGTTCGGGACG
GTTCACAAGGGCATCTGGATACCAGAGGGAGACACGGTGA
AGATTCCCGTGGCCATCAAGACTATTCAGGACCGCACGGG
GCGACAGACCTTTCAGGAAATTACTGATCACATGTTGGCA
ATGGGTAGTCTGGATCACGCGTATATTGTCCGCATCCTGG
GCATCTGTCCGGGTGCCAGTCTGCAGCTGGTCACTCAGCT
CAGTCCACAGGGCTCTTTACTGGATCACATCCGCCAGCGC
AGGGACAACCTGAACCCGCAGAGGCTGCTGAACTGGTGTG
TGCAGATCGCCAAGGGCATGTACTATCTGGAGGAGCAGAG
GATGGTGCACAGAAACCTGGCTGCCCGAAATATTCTGCTC
AAGAGTGATTTAATTGTTCAGATAGCCGATTATGGCATCG
CTGACCTGCTCTATCCTGATGAAAAGAAATACTTCTTCAA
TGAAATTAAGACTCCTATAAAGTGGATGGCCCTTGAGAGC
ATCTTGTTCCGCAGATACACTCATCAGAGTGATGTATGGA
GCTACGGTGTGACGGTCTGGGAAATGATGTCATACGGGGC
AGAGCCTTACTCTGCGATGCGACCGCAGGATGTTCCTGAT
CTGTTAGAGAAAGGAGAACGACTCTCTCAGCCTCAAATCT
GCACCATTGACGTCTACATGGTCATGGTCAAATGCTGGAT
GATTGATGAAAATGTACGTCCAACTTTTAAAGAGCTGGCC
AATGAATTCACCCGAATGGCTCGAGACCCACACCGTTACC
TGGTCATCAAAGAGGAAGACAGAGCCCCAGACTCAGCCTC
AGATGAGACTCATCAGAATGGTACTGAAATAGACATTCTC
GGGGTGGCACTGGAGGACCAGGATGATGAAGTCTTGGAGG
ATGCCATAGATGCTCCACGCTATATAACACCATCTAGAAG
CTTCTCTAGACTGCGTATAGATTCTCATCGGTCAAGTTTG
ACTCCATCCACTACTGCTGGATATCTACCTATGACTCCGG
GTCTGGAGAGCTCTGTACAGACTGGATGGGCGTCTCGGTC
CCGTCTGGACTCAGCGTGCACTGTTTCTGAGAGCTCGGAG
GGACGAGGAGCGCTGGAACTGGAAATGAATGACGACTTCT
CATCCGTTGGCAGTCTAAGGAGGGTCAGACATCGTGAAGA
CAGTGCTTACATGTCACAGCGGGACAGTCTTTCAGGACCA
CCAGAAACAACCTCCACAGGAACTCAAGGAGAAGAAGACC
AGAATGAATATGTGCTGCCTGGATTCGGTGAAAGCCCAGA
GAAAGAAACTCTTCTGTTCACATCATCACGTTCAACGCTT
TCTCAAAAGAGACTCTCGAGAGGTCATTCTGGAGACTTTC
TGGAAGCCAACAGAGGTGCTGGTGAAGAATACGAGTACAT
GAACAACCAGACGCTCTCTCTCAGCCACATACCAGGACAG
CTAAAAGAGTACAATCAACGAGCGCCACGAAACCGCAGCG
CCTCCTTTAACCCTGGCGGGATGTACAGCAACCACAAACC
CAGCAGACCTAGTAAGAGGTCATCGATCGAGGGCTCGGAA
AGCAGCGGAGGACTCTCTCAATCCTCAACTGACCAGAGGA
GTCACAGCGATGGAGATTTCCTCTCCAGTGAAGCAGAATA
CACAGATGGGGATCTGGAGGGCGGTGGAGGAGAAGCGTAT
GAATATGAGGATATGGACTCACTGGCTGCAGGCGGAGCTT
CGGGAGCTGAATATCAGAATCTGGATGGAGAAGATGAGGA
AAGGGATGAAGATTGGTCTGGAGGACCTCGTAGCCCGGGA
CCGTATGTACAGGTGCACGCTGGGACCAATCATAATGCTT
TTGATAACCCTGATTATTGGCACAGCAGATCATTTCATAA
AACTAAAGCTGTCCGCACGTAGAAACGGAAACAGCTTGAA
GGAACTTCATGCAAATGATCAAATGTTCTGGATGGTTTTC
AGAAATGCACTTCATACTGCTATGAGTCCAGGGGAAAAAA
ACTGATGCGATGTATTTTGATGTAAATTGTATTGTTGTTG
TAAAATAATGGGGCATTAAAAGGTTAGTAGTGCTGTTAAA
ATCAACAGTGTGAAATCAAAATGGACAATGTTTATTTTGC
TAGCGCATATTGTTATTCCAACCTGATCTCACGAGGAAAC
GTAACTATTTTACGTTGTGTCAGTTTAGTAGCTAATTCGT
ACAAGTTCAGTCTTATGAAAATGTACGATTTTAAAAAGAA
GCCCACCCCTAAACCCAACCATCATTGGGGGATCAGCAAA
TCGTACTCAATTGTATGAAAAACGATTTTATACAAATTAG
CCGCTAAATCAATAAGTTATGAATTGGCGTGAGATAGCGT
TAATCCAATGCATTTGGAGTGATGGTGCTTCTGTTGACGT
CAGGTCAACCACTCACACATTATTTTTAACCATGCCCCAT
TTGCAATTTATATAAGGGAATGATGCGCAAAATGTAAGCC
CCGCCCCCTTTTCAATAGTCCTTTTAAGTTGAAAGTACAT
CAACTTCCGGTACGCGCAGACTTTAAACGAGTAATCGTGA
CTTATCGCATACAAAGCTAAATTTGCAAGTGTGATTATTA
TGAATATATAAATACATCTATGCGTATCTACATGTATAGA
AAATGTTTGTTTATATTTAGATTATTATAACCCAAAATTA
TATATCATGCTAGAATATATGAAAATTAGTATATACACAT
GCATATGAGTACATTTGTATTGTCACGTAAGTGTTTGAGA
CAACAGAGGCGAGGATCCACGTGCGGTTTATTAACAAGCA
TAGTCAGGCAGGCAACAATCAAGACTTGGGGAAACAGGAA
CTTGCAGGAAATCCTGAATTGTAGTCAAAAGCAGGGCGAA
TGTTAAGTACAGACAGCAAAGAATCAAGTTAAATCGTAAA
ACAAGGCAAAGATCAAAACAATGGAAGGCAAGACGAGGAT
AGCGCTTGCGTGATGCTCTAAACATAAACAAAACAGCAAC
GTTGTTCTTCTAGTTTTATGACTGATGCCGCGGTCACGCT
AGAGTTTGAACATGCAAAGTTCTGTCATACGGCACTGCGA
AAAGGGGCGGGATTAAAGAAGAGGATTAGACATTTAAAAA
AGTGAACGATTGGTCCATATTTTAAATTTCTGTACAGAGA
GGTCATGTTTTGATCTTTGATTGGTCTCACACAACCACAT
GATGCGATATTGCAGGTCAGAGTTCACCAAGGTTGAACTT
TCTAAATCAGCCAACTGCAAAACTTGTCGCACGAGCTTGC
ATTTCCAGTCTGTCACATTAGCGTGCTTATGGAATGGAAG
TCTATAGGGAGAGAAGTGCAGCGTAACCCCGGCATAATAG
TGCATTACAGCCTTCTATCTTTCAAATGGACCAGACACTC
CTGATTCCTGATTGACCTACATACCCACAGACAATCACTC
TTGGTTAAACCAGTAACTGGTTCAGAGACTTCATTGAGTT
TCCTCCTTCCACCCTTAGTACTCTTGGTGAGACTCAGCAA
CAATGTGTGTGTGCTGTGTTTATGGTGCATCTAATTAGTC
CTGAACAGCTTTAACTGTGTGTGTTTGCAATCAAGGCCAG
GTGTGTGAGTGAAGCGCATGATGGGATTTGTAGTGCAGAT
GAATGTGAGTGTTTTCCAGCAATCTGCAAGAGCAACACTA
CTGGTGATCATATGCATAATAAATATACACAATACACACA
CACTTATTATGTACATACAACTTTTATTTTGTACTTGATT
AGTCACGGTTATTGTTAAACAGCGCTAGTTGAAATAGCAT
AGCAGCTTTGTTCTTGTATATATATGTGTGTGTGTGTGGT
GG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations