Community Action Needed: Please respond to the NIH RFI
Transcript

mllt10-204

ID
ZDB-TSCRIPT-110325-927
Name
mllt10-204
Previous Names
  • mllt10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028949 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028949|OTTDARG00000022481|ZDB-GENE-041114-176 mllt10|OTTDARP00000023675 mllt10-001 LG_ CR376737.4 Danio rerio protein_coding KNOWN, 4589 bp
CGGGGTTTATGCGTTCAACAACAGCGTAACTGAAATATGG
AATTTAATGGAAATGGGACTTAAAATACTGCTTTCATGGG
AGATAGGGATTCGTGAGACAAACGCCCGACTGCCTTTTTG
TTGGTCTTTGTGCGCTGCTGATGGTAGATGGTCTCCAGCG
AGCTGTATCTGGCAGAAGAAGACGACGATTCGCCAAGTAA
TATGAAGGAGATGATCGGAGGCTGCTGCGTCTGCTCGGAT
GAGAGAGGCTGGGCCGAAAATCCCCTAGTCTACTGCGACG
GCCACGGCTGTAACGTTGCCGTCCACCAAGCCTGCTATGG
AATTGTCCAGGTCCCCACAGGCCCTTGGTTCTGCAGGAAA
TGTGAATCACAGGAACGTGCTGCCAGGGTGAGGTGCGAGC
TGTGTCCCCAGAAAGACGGAGCACTGAAACGGACAGATAA
TGGAGGTTGGGCCCATGTGGTTTGCGCTCTTTACATCCCA
GAAGTGGAGTTCGCCAATGTATCCACCATGGAGCCCATTG
TGCTTCAGTCTGTCCCCCATGAACGTTATAACAAGACATG
CTACATCTGTGAGGAACAGGGTCGTGAGAGCAAAGCTGCT
ACTGGAGCCTGCATGACATGCAATAAACATGGCTGCAGAC
AGGCCTTTCATGTCACATGCGCTCAGTTAGCTGGGTTGTT
GTGTGAAGAACAGGGTTCAGATGCTGATAATGTGAAATAC
TGTGGATACTGCAAGTACCATTACAACAAACTGAAGCATA
AAGAAAGAGATCGGCATAAACCAAAGCACAAAAAGCCTTT
GGAACTGTCGCCTTCCCTGGTGCCAGCGCTGATGGTGACA
CCTGAAAAGAGTTACAACAACAGCAGCAGTGGCGGAAGTG
TGTCGTCCATCTCCTCCACTCAGAAGCGACTGGACGACAG
CGGAGCCCGTTTCACCAATGCCAACTTTCAGGAAGTTCCA
CCTCACTCCAGTTCCAGTTCCAAAGATGGTGGCTCCTCTG
ATGGCAAGAGCTCGGACAGCAAAAGCAAGAAATCCAGTCA
CAGCACTAGCTCAAGCTCGGGTTCACGGGGTCGCAAATCT
GTGGCAGGCAAACCCCACGGCCCTGTGGTCACCACAGCTA
CTTCATCCACGGCCCCTTCCTCAACAAGTCCTTTTCAGCA
AGGTGAGGCTTCCAAACATGCCAACTTCACTTCATCAACA
ATCTGAAATGAAATTAGTAAACACCCTCTCCATGTTTCTA
AATAGACTGAAACAGCCAGATTCAGGTCTCTTAGAGTGAG
TCTGTTGTGACATGGCTGGATGGAAGCCAGGAGTTGTAAG
CTTGGCGTGTGTGTGCGATAAGGCTGTCGTCTGGCTGGCT
GCTGCTGTAATGCAGATCGGCGGGTCTTTCCGAGTCGGCT
AAACCTTGGGTGGCGTCTCTTGTGTGTGTGTTTATGTGTG
TTATGAGGGAGGTTTGGGAGTCAGAAAAGAAGCATGTTCC
TTTCCTTTCTCATATCAAGCCATGATGGAGGGATTGAAGC
AGAGGTCACGTCTGGAAAATTCAGACTAATCATTAATGTG
TCAAAGTGCACAGGGGCCTCCTCTCTGGAGTTACATGCAA
ACTTCAAGGAACCATTAGCTGCATTTCCACTATCGGACCA
GTGCGAGCCAGGGCTTTAATCGGGCCGGGGCGGGCCAATA
GCCCGGGAGGTTGAGAAATGAGGCTGAAATCATGTCGCGT
TTCCACTGTCGGGCTAAAGCTCACAGCGCGTCACGCAAAC
ACCGCCCACAGAACGTCCCCGAATCAAACGTCACACAACC
CGCCCACTTCAGCGGGAATGAGGCAGATAAAGCACACCAT
AGAATCATCACGAAACGAAACCATTAAAATGAAGACAACC
GAAACAAACAAACGACACGTTACTGTAAAGCAGTACATTA
TATGTCTGTAAGCACAGACCTGTGTATTTCCATTCATTAC
ATTTGTTTACTCGCCGACCGACTGCATTGTGCATGGAGTG
CTCTCGCCACTAACGCAGGGACCCAACACAGAGAGCGCAC
ACATCCATAATATAACAGAAATTCTCCTTTATAACTCGAT
ATGGCATGTATATTTTAACATCCTCGTGTTGATAGAAGTC
GTGTTAAGTTTTCAGCACAAGAGCGAGAAGCCTAATAAAA
TATAGCCATATTTGTTGCGCTCGGCAGCTATTCACTAAAA
CTCCTCATTTAAAGTTTCATTTATAAATTTAACCACGTCA
TATAAAAACATAAACAGTTGTTTGAGGATATAGAACACAT
TTTGTGTTTAGACTTTCCCCCATATGCGTTTAAAGCAGCG
AGTGCTGCGCAGGACTGAGTGACAGAAAAAAAGGTATAGG
AGATTCTGCTTTCACTCACCCAAATAATGCTCTGTTTGCG
CGATTTGATTAATATCATCGTATCCAAATACTTTATAAAT
ATTTACTTATATAAATATTTACTTTATATAAATATTTCAA
ACCTTCTCCGGTGTTTATTGTTTTTAAAAAATATCGAAAA
TCTTTTTTTTTTTTCAGACAGGTCTTTGCAAAATGAAAGT
TAGGCTATATGTGGCTTTAAAACGGTTTGATTTATGTATT
GTATATAGGCTACCTACATTGTTATAGTTAGCTTTTGTTT
ATTTTATATTGGTTAATTTATTTAATGTGATTTTATATAT
ATCCGGTATTTGTAATTCTTTAAATTATATTTCAATATAC
CTTAGGCTATTTTATCAAGATATGACAATATATTGTTTAA
AGTCTACGAAAGTGGGCACGTATTTTGTTAAGTTTATGTC
TTTCTGTTGTATTTATATGTGTATTATCTCCAAAATAAAT
AAAGAAAAAAGCCGCTCGCGGCTAGAGCAGTGAAGGAGCG
CTTTTGCCCGGTCTCACACACATACAGGCATCTAAACGTG
CACAAACAAACAAACATTTTAAACTTGACAAAAACTCTCG
AAAACCTTTACTGTCTGATGTGTTTTTAATATGGTGTAAA
GATTATTATGCGTTATTTAAACATAAAGGAGGACGCAGCA
AAGAACGTCACTATAAATTAAAACTACTTTATTATACGCA
AAAAGACCCCAGACTATAAGGCTAAATGTTTTCTTTCCCT
TATTTCTTTATTTGTTTGGCGCATGTACTCATGTGCGATC
AGAAAACTGCCCGCCTCTCCTTTCACTCCACCCCGAAGCC
CCAGCTGGCCCTCCTTGGCCCAAGGTATTCGGCGGGCCGA
AAAAGGCCGGCCGCTGGCCCCAAGAAAGCCCCGCTTTGGC
CCGATTAGGCCCCGGAAGTGACAGTGGAAACCCCACTGGC
CTTGGCTCGCCCTGGCTCGCTCGCTTTAGGCGCGATAGTG
GAAACGCGGCTATTGAAGGAGGAACAATGCCTTGTTTTCT
CAGCAATGAGATCAAAAGATGTTGAAGATTAACCATGGAG
TCTGTAAGAATGTCATATTGTCTTGGCTGTTTTGACAACA
CCTGACACAGACGTGGGGTCGATGAGCCACTCAGCAGTTC
AGTTTGGCCACCATGGTGTAATATTCCAAGTATATGAGAG
ATTGCAATCTTATTAAATTGAGCCCTTTGCGTTTGACAAT
AACAGTGGGGTGTAGGACTATGTAGAGCTTATTTTCCATA
ATGGTGCACATGCGAATCTTCTTGTTGACATAAGAAAAGA
TATAAAAAGTAATATTGTTTGAGGCAGGATTTAAGATTTT
TAGTCAAGTCGTCTTATCTTCAGGCATTAAATGGACAGTG
ATGCTTAATCTAGGATCCAGCGATAAGGTGCAGCCAAACT
TCCTGGATGCGTTTTGGAAAGAATACAAAATGCGTTAGTT
ATCTTGTGCAGTCGTCAGACCAGTTGTTTTTGTGATATGG
TTTATCTTTGAGAAATGTTAACTGGCCTCCTCTGCTTTGT
GCATGTTTGAATGTTAGTGGGAGGCTTACAGGATAAATGA
TGTAGTAATATTGGGAAGTAAAGCCTCAGCAGCCTCCTAC
AACAGCTGTAAAAACATGGAGGGTTTCTCTGGCATTGGTT
AAAGGACGAGTCCTTCCCTGAGGGGAGGGCTTGAATGAAC
ACCTAGATCTGGGTCACCCTTCTTGTCTGCTTGCATACCT
GATTGTTTGGATTCCTGCAAGTTTGTCTGGTCCAACTTGG
AGTGGGAGATGATGACTGACTGACTGGTTTTAGGTTGGGT
TGTTTCTTTGTTGCTTTTTTGAAGATTTTTGCCTTTTTTA
AATTTTTTCAATAATTCTAATTTTAAGTTTTATTTATTGT
CATTAATAAATTGAATGGGCTTTCTTTAAAAAAAAAAGTC
TTGTCTAGATGAAATGATGTTGGTTTTTGAAAGACCTGTG
GGGTTTTTTGTTTACCTTTGTTTAAATAACTTTTGACCTA
TTTATTAATCAATCTAGGGAAAAAAAGGTTTTCATGAAAA
TATTTGACAGCACAAAGGTTTTGAGCTTTTCAGTTATGAA
AAATGATTATGTTGTCTTTTGTAGTATGTCAGAAAATGTA
CAGAGTTTGATATTAGTGAATGTTTGTGTACAGGATTTCA
ACCTGTTAATAAAGTTGTTCAGTTCAGTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations