header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-55
Transcript Name: mllt10-004
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044513 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044513|OTTDARG00000022481|ZDB-GENE-041114-176 mllt10|no_translation mllt10-004 LG_ CR376737.4 Danio rerio protein_coding KNOWN, 834 bp
CTGAGCCGCCAGAGAGACCACTCTCTAGCCCCTAGATGGA
TTTCTATGAGGGAGATCTGATGGCTACCAGTCTGGCGATG
GATCGAGCGGTTTCCCAGGCTTCTCTGGTGCACACATCTG
CACACCGGCTCCTTATCGACTGCTTTCTGTTTATCTTTCA
GATCAGGAGCTGGGAGACGGAGCTCTCGGCTTCTCCAGAA
GAGGAAACTCACCAAAGACAAACCTCTCCCCTCGGTCTCC
GCTGAGTGGGCTTCATATACGGTATGACGCAGGACCTATG
GTTCCAGGGCTCGGGTCTGGTTCGGATACGCTGCCCCCTG
CGGCCACCAGCATTGACCAGCTGCTGGAACGCCAGTGGAA
TGAAGGACAGCAGTTTCTTCTACAACAGGGTTCACAAGGA
GATGTTCTGGCAATGCTGAAGTCCCTGCACCAGCTGCAGG
TGGAAAACCGGCGCCTGGAGGAGCAAATCCGAACTCTCAC
CATGAAGAAGGAACGACTGCAGCTCTTGAGCGCTCAACTC
TCTGTGCCTTTCACCCCTGCAAGCACCACGGCCACCACTG
CCTCCTCTCCAATGTACCCCAGCAACACTCACACAGACAT
GCTGCACAGCAAGAGCATTCAGCTAGGCAGTGTTTTAACA
GAGTCCTCTCAACCCTTGCCCACTCAGGATCCCCAGTCTG
GTGGCCATAGTAGCGGAAGCAGCACGTCGTCTCTCTCCAC
CCCTCCGTCTGCAGCCCACAGCCCGCCCCAGCAGCAGGTG
AACGGAGTCGGCATGGCCGGGGTGCCTGTCCAGCCTGGCA
ATGCCAACTCGTCCCTGCCTGCCATAGCCGGGGT

mllt10 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA mllt10-004 834
mllt10-005 (1) 840
mllt10-006 (1) 784
mllt10-007 (1) 714
mllt10-008 (1) 711
mllt10-009 (1) 849
mRNA mllt10-204 (1) 4589
mllt10-206 (1) 6768
mllt10-208 (1) 5383
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mllt10-004 Contained in:

OTHER mllt10-004 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044513 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK148471 (1) 784bp
    GenBank:FP120100 (1) 684bp
    CITATIONS (1)