Transcript

mllt10-006

ID
ZDB-TSCRIPT-110325-1865
Name
mllt10-006
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044515 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044515|OTTDARG00000022481|ZDB-GENE-041114-176 mllt10|no_translation mllt10-006 LG_ CR376737.4 Danio rerio protein_coding KNOWN, 784 bp
GCAAACTCGCTACCGGGATCCTTTAACCTGGCACCATCCC
ATATGTTCGGAAACCGACTGAATCCTAACTCCGCCATGGC
TGCACTGATCGCTCAGTCCGAGGGCTCCCCAGCAGATCAG
GAGCTGGGAGACGGAGCTCTCGGCTTCTCCAGAAGAGGAA
ACTCACCAAAGACAAACCTCTCCCCTCGGTCTCCGCTGAG
TGGGCTTCATATACGGTATGACGCAGGACCTATGGTTCCA
GGGCTCGGGTCTGGTTCGGATACGCTGCCCCCTGCGGCCA
CCAGCATTGACCAGCTGCTGGAACGCCAGTGGAATGAAGG
ACAGCAGTTTCTTCTACAACAGGGTTCACAAGGAGATGTT
CTGGCAATGCTGAAGTCCCTGCACCAGCTGCAGGTGGAAA
ACCGGCGCCTGGAGGAGCAAATCCGAACTCTCACCATGAA
GAAGGAACGACTGCAGCTCTTGAGCGCTCAACTCTCTGTG
CCTTTCACCCCTGCAAGCACCACGGCCACCACTGCCTCCT
CTCCAATGTACCCCAGCAACACTCACACAGGATCCCCAGT
CTGGTGGCCATAGTAGCGGAAGCAGCACGTCGTCTCTCTC
CACCCCTCCGTCTGCAGCCCACAGCCCGCCCCAGCAGCAG
GTGAACGGAGTCGGCATGGCCGGGGTGCCTGTCCAGCCTG
GCAATGCCAACTCGTCCCTGCCTGCCATAGCCGGGGTGAC
GGGTCTGATGGGCGCTCTGCAGGGCAACCACCTGGCCATG
AGTGGCATCGTGGGCGCCTTAAAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations