Transcript

dmxl2-003

ID
ZDB-TSCRIPT-110325-548
Name
dmxl2-003
Previous Names
  • ch211-165a16.2-003
  • si:ch211-165a16.2-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049546 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049546|OTTDARG00000034894|ZDB-GENE-031007-6 dmxl2|no_translation CH211-165A16.2-003 LG_ BX908722.4 Danio rerio protein_coding NOVEL, 754 bp
ATTATCTAACTGTTACAATATAATAGTATAATAATTATAA
TACTACAGTATTTATGTTATAGTATAATATAATATATCAT
AATATATAATATAATATAATACAATATAATATAATATAAT
ATCATATAATATCATATAATATAGTCCAATAGTAATCGCT
GTGAATTGTTACTTATTGTTATCATTGAAATCAAAAAAAT
ACAATTAGAATTGAATTACAGGTTTCTCTAATTCAGTGCT
ACTGTATGATATCAAAATACGCTTGTGTGTGTGTTTGTCT
CAGAGCTGGCAGTGTCACAGTAAAAGCTGTGGTGATTTTG
CCTTCATCACGTCCTCTAGTCTGATCGCCACAGCGGGACA
GTCCAACGATGGCAGAAATGTCTGTTTATGGGACACACTG
ATCGCTCCTAGTAACTCCATGATACACTCCTTCCAGTGTC
ATGAGAATGGTGCGACCGTTCTTCAGTACGCTCCTAAGCA
GCAGTTGATCATCACGGGCGGCAGGAAGGGATTCGTCTGT
GTTTTTGACATCCGTCAGCGGCAACTGCTGAACACATTCC
AGGCACACGATTCGGCCATCAAAGCCCTGGCCATGGACTC
CAGTGAGGACTTTTTTGTCACTGGTTCGGCTGAAGGGAAC
ATGAAGGTCTGGAAGTTGGCAGGTCATGGCCTCATGCACT
CATTCAGCACCGAACACGCCAAACAGTCCATATTCCGCAA
CATTGGGGCCGGCGTGATGCAGATTGAAACCTGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations