Transcript

dmxl2-202

ID
ZDB-TSCRIPT-110325-2363
Name
dmxl2-202
Previous Names
  • dmxl2-001
  • ch211-165a16.2-001
  • si:ch211-165a16.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049545 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049545|OTTDARG00000034894|ZDB-GENE-031007-6 dmxl2|OTTDARP00000038865 CH211-165A16.2-001 LG_ BX908722.4 Danio rerio protein_coding NOVEL, 3321 bp
CGGTTCCTCCTCCAACTCCTCCCGCTGAGGATGTAGACCG
TCAGCGGCGCAGGTTTAATATGCGCATGCTAGTCCCGGGA
CGCCCTGTTAAAGAGACTCCAGCCACACCTCCGCCCATTC
CTGTAGAGCGGCCCACCTATAAGGAGAAGTTCATCCCACC
CGAACTCAGCATGTGGGATTACTTTGTGGCCAAACCTTTC
CTTCCTCTTTCTGACAGCGGGGCGCTGTATGATTCGGATG
AGAGCGGTGCTAGTGACAACGAGGATGATGATGATGCCTT
CCTCTCTGACACCCAGATGACCGAACACTCCGACCCAAAT
TCCTACAGTTGGTCTCTGATCCGCCTGGTGATGATCAAAC
ATGGCCTGCACAATGTCAAGACATTCCTGCCCCTGGCTGG
ACTGGACTTCACAGAACTACCAGTGACATCTCCACTCTGC
AATGCTGTGCTGAAGACTTTGGAAAACTGGGAGCAGCTTC
TCTTGGAAAAGATCAACAAGTTTGATGGCCCGCCACCAAA
CTACATCAACACCTACCCCACTGACCTTAGTGCAGGTGGG
GGACCGGCTATACTCCGACACAAAGCCATGCTGGAGCCAG
AGAACACACCGTTTAAGTCAAAGCACCATCTGTCTTTCCC
TGCTCGCCGTCTGTGGCATTTCTTGGTCAAACAGGAAGTG
CTTCAGGAGACTATGATTCGGTACATCTTCACTAAGAAAA
GGAAGCAGAGTGAGGTGGAGGCTGATATGGGTTACCCCGG
AGGAAAAGCCAAAGTCATCCACAAGGAATCAGACATCATC
ATGGCATTTGCCATTAACAAGGCTAACACTAATGAAATAG
TGCTGGCGTCCACTCATGATGTTCAGGAAGTGGATGTGTC
CACACTGGTCGCAGCTCAGCCATACACCTGGATCGGAGAG
GACTTTGACAAGGAGTCCCGCAGCTCTGATGATGTCGACT
ACCGCTCGTCTCACACCAACATCGCCCAGGCCAGCACTGG
TCCCTTTGCCCCCCAACAGATGGCAGCGTCCTCCTCCATG
CCCTGGCTGGGAACCGGGCAGACCAGCATGGGAGCCAGTG
TGATCATGAAGAGGAACCTGAACAATGTGAAGAGGATGAC
GTCCCATCCTATCTATCAGTACTATATGACTGGAGCTCAG
GATGGTAGTGTGCGAATGTTTGAGTGGAATCGTCCACAGC
AGCTCATCTGCTTCCGGCAGGCTGGAAACGCTCGAGTCAC
TCGCCTCTACTTCAACTCACAGGGCAACAAGTGTGGCGTT
GCAGATGGTGAGGGATTTTTGAGCCTCTGGCAAGTCAATC
AAACCTCCTCAAACCCAAAGCCCTATTTGAGCTGGCAGTG
TCACAGTAAAAGCTGTGGTGATTTTGCCTTCATCACGTCC
TCTAGTCTGATCGCCACAGCGGGACAGTCCAACGATGGCA
GAAATGTCTGTTTATGGGACACACTGATCGCTCCTAGTAA
CTCCATGATACACTCCTTCCAGTGTCATGAGAATGGTGCG
ACCGTTCTTCAGTACGCTCCTAAGCAGCAGTTGATCATCA
CGGGCGGCAGGAAGGGATTCGTCTGTGTTTTTGACATCCG
TCAGCGGCAACTGCTGAACACATTCCAGGCACACGATTCG
GCCATCAAAGCCCTGGCCATGGACTCCAGTGAGGACTTTT
TTGTCACTGGTTCGGCTGAAGGGAACATGAAGGTCTGGAA
GTTGGCAGGTCATGGCCTCATGCACTCATTCAGCACCGAA
CACGCCAAACAGTCCATATTCCGCAACATTGGGGCCGGCG
TGATGCAGATTGAAACCTGCCCAGGAAATCGGATCTTCAC
CTGCGGTGCCGACGGAACCCTGAAGATGAGGGTCCTTCCC
GACCGCTACAACATTCCGGCCAGTATATTCCAGATCCTCT
AACAGCGGAGCAGCCCCCGGAACACTTAACGCTTTCATCG
ACACCTCTGCGTTTCCTTAGCTGTGAATCGTAAAACCGGT
AACAAATATCTCGCACCTCGCCCCACGAAAAAAAAAAAAA
AAACACGCCGAGGTCCCTCGATTACTGAACGATCGACTCC
GGTTAACGAGAATCCGGATAACGTGTTGGTAGGAAAAGCC
GTATGCATGAGCTGTTTGAGTCATCGCACTCCATTCCCAG
GTTATTGGTCGTGCTCTTGTAAAAGTGCTCAAAGCTCCAT
TTTTAGGTGTGTATGTGTGTGTCTTCATTTTGTGCCCATT
TTAGCATCGAAAAATACCAGCACTGTGCTTCTGCTCTCAG
TGTAAGTCCAGTTGTTGGGGTTTTTGTTTTTACTGTACGT
TTTCTCCTTGGCTGCTAATGTATTTGCGGAGTGTAAAATG
GCACAGTACCCTGGTGGCCCGGCGGTTCGTCACGGCCCCA
GAGACACAACCCTTTCCCTGCCACACACACACACACTCAA
ACACACACACAGACACACACAAGTGCGCACGCTGCTGTCG
ACACGCAAACATTCCACGCGAGACAATGGCGCTTGCTCCT
GGAAATGACGTATTTCACTTCTTCGTCCGTCAGAGCCCTC
AAAAATCCTCACTTCTAACTGAAATGGTTTTGTTTTTGCA
CAAAATATTTGTTTGTTCGTTTGTTTTTCCGTTTCGTTCG
TTCTTTTACCAAAACGTGTCGTATTTATATTTACCTTTTA
GGAATGTAAGGTATGTTTTAGATGTCTGGGATCAAAGTGC
AACACTGAATAGCTTTGTGTTTTATTTATTTACATATTTA
TTTTTTCATGTTTTATCTCTTCTAAATATTTGCACTCAGA
TCTGGGGAAACAATACCAGTCTCGTGTGGTAAAAGCTCTA
TTAGAGGAAACTGTTATTTACAAATGAATGTCTGGCTGTG
TGTGGCCGAGTAGTTACAAAGTGGAAATAGTTTTAAACGA
ATAAATATATATATATATAAATATAAATATATATATAAAT
GAAATATTACAATAGCTTGTACAAACACAATAATGCTTTT
ACTTTATTTTTTTTTTATTTGATCTTAACTGCTGGAATAG
TCGTATCTTTGGTTTGACGTACACGTGGTATTTATTAAAT
CATATTTGTGTTTCTGTCTGATTTGCTGGGCACCATGTCA
ACTGTACGTACTTTTAAATGTTCAAACCGATGGTCTGATG
TGTATTTATTGAACAGCCTGATCCGTCTGCGTGTGTGAAA
AATGCAAACACCTCCCCCAAAAACACTGGTTGATATTTCC
CTGAAGGAAACAACAGGTAGTTCTGTCATGGTCAAAGTTT
TACCTTTGTAAGTTGAATAAATTCTTTTTATTTGAATTAA
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations