Transcript

dmxl2-201

ID
ZDB-TSCRIPT-110325-1456
Name
dmxl2-201
Previous Names
  • dmxl2-002
  • ch211-165a16.2-002
  • si:ch211-165a16.2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049547 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049547|OTTDARG00000034894|ZDB-GENE-031007-6 dmxl2|OTTDARP00000038866 CH211-165A16.2-002 LG_ BX908722.4 Danio rerio protein_coding NOVEL, 276 bp
CCAGAGAACACACCGTTTAAGTCAAAGCACCATCTGTCTT
TCCCTGCTCGCCGTCTGTGGCATTTCTTGGTCAAACAGGA
AGTGCTTCAGGAGACTATGATTCGGTACATCTTCACTAAG
AAAAGGAAGCAGAGTGAGTCTATAGATGATCATGTGGACC
ACCTCATACAAAACTACGTTACTGGAGCTCGCAAAGCCAG
CAAGGTGGAGGCTGATATGGGTTACCCCGGAGGAAAAGCC
AAAGTCATCCACAAGGAATCAGACATCATCATGGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations