Transcript

hnrnpaba-206

ID
ZDB-TSCRIPT-110325-519
Name
hnrnpaba-206
Previous Names
  • hnrnpab-006
  • hnrnpaba-006
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000049453 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049453|OTTDARG00000034843|ZDB-GENE-030131-185 hnrnpaba|OTTDARP00000038789 hnrnpab-006 LG_none FQ377590.3,CU658205.6 Danio rerio protein_coding KNOWN, 1285 bp
CAAACACTGGACGTTCAAGGGGATTCGGGTTCATTCTTTT
CAAAGAGCCATCAGGTGTAGATAAGGTTTTAGCACAAAAG
GAGCACAGACTGGATGGACGACAGATTGACCCCAAGAAGG
CAATGGCAATGAAAAAGGAGCCAGTTAAGAAGATCTTTGT
TGGCGGACTGAACCCTGAAACCACAGAAGAGAGGATCCGC
GAGTATTTCGGTGCCTTTGGCGAGATTGAGACTATCGAGC
TTCCAATGGACCCCAAGTCAAACAAGAGGAGAGGCTTTGT
CTTCATTACCTTCAAGGAAGAAGAGGCGGTCAAGAAGATT
CTGGAGAAGAAATATCACAATGTCAGTGGAACCAAGGACA
CAAGCGGAAAAGAAGGCCTTTGTGAGATTAAGATTGCACA
GCCTAAGGAAGTGTACCAGCAGCAGCAGTATGGAGGTCGC
TTTGGTGGAGGAGGAAGAGGAAGGGGGCGTGGAGGTCAGG
GTCAGAACTGGAACCAGGGCTACAATAACTACTGGAATCA
AGGCTACGGAAACCAAGGCTATGGCGGATACGGCGGGCAG
CAAGGCTACGGAGGATACGGCGGCTACGGGAACTACGACT
ACTCGGGCGGCTACTATGGCGGATACGGCGGATATGACTA
CAGTCGTAAAGCTGCCGAGCAGGAACCAGCGGTCTGGTCG
CAGTGAACGTTGGGATCTTTTACTTTTTGGAAGTTGGCAG
AATCTGGACTTCTGCTTCATTTTGTACAGAAAACAAAAGG
AACTGGGGGGGCGCAAATGTCACTTTTCACATTTGTTTTA
TTTTACTTTTGTTTTTTGTTTTTGTTTTATTTTCGTGTTT
TGTGTCCTTTTTACATTTCCAGAAATGGAAGTGTTATTTT
TTTACTGTACTTTTTGGTACCTTTTTGAATCTAATGTATT
GTATGGTTGTATTTTACATCATGGCTGTGTCTATCACATC
TAGGCTCAGAGCTCTCTAAAAATGCTTTCAAAATAAACAT
TTTTGGTTGATTTTTACTTCTTTTGGTTAGTGTTCCTAGA
TGATTTCCTTTTCTCCCCCTAGTGTCACCTGTGCTTTGTG
TTGCATGGCTTCACGGTGAGATGAAAAGGGATTTCTTTAT
GATTGTAAGCTTGTCCATTTTGAAATCTGTTAGCGGCAAG
TCTTGGTGACATTTTTATTCTTTTAATTTGTTTGTTTTTT
TTCCTCTCCCTGTACTGCTTTTAAGGAGACTTCCTCCCAT
CGTGTTAGATATTTAAGAGTGGCTTTAATAGTGATTAAAC
TATAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations