ZFIN ID: ZDB-TSCRIPT-110325-2333
Transcript Name: hnrnpaba-003
Previous Name: hnrnpab-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049449 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049449|OTTDARG00000034843|ZDB-GENE-030131-185 hnrnpaba|no_translation hnrnpab-003 LG_none FQ377590.3,CU658205.6 Danio rerio protein_coding KNOWN, 787 bp
GAAGGGCCCACACCGCGGAAAGCGTTCCACGGAGACTTTT
CACTTGCTGCTGTTACGGTAAGGTTTTAAACAGAAAATAA
CGATTTTTGGCACTTTTAGTGCACATATTTCGTCGTGTTA
ACGTTTACATCTAATCTCACGCAACTAAACGGTCAGTATT
GCTAAACTGAGACCGTGATATGTTTACATTCTTGTTGCGT
ATGAAAATGTAGGAGCCGCTGTTCAAAATGGTGGGGTGTC
TGCGTTACATAAGGCGCTTCCTTTCGTAACCATTTCCCTC
GCATTTTCCGCAGTTTTTAGGTTTTCACATTCAACTACCA
CCATGTCAGACGCCGAGCAGCAGTATATGGAAACCTCACT
GAACGGCCACGAGGGTGAGGATGATTTGAACGGAGCCGGG
CAGTACGATCAGGGCAACGGGGATGCGCAGGCCGGGGCGC
AAGGAAACGCCGGTGCGGACGGGACGGCCGGAGACGATGG
AGCGGACGGCGGGCAAATTGATGCGAGCAAAGGAGAGGAA
GATGCGGGGAAAATGTTCGTCGGGGGCCTCAGCTGGGACA
CCAGTAAAAAGGATCTTAAAGATTATTTCTCTAAATTTGG
AGAGGTGACAGACTGCACCATTAAAATGGACCCAAACACT
GGACGTTCAAGGGGATTCGGGTTCATTCTTTTCAAAGAGC
CATCAGGTGTAGATAAGGTGAGCTTCAGAGTCCATGAAAA
CCTCTGGTTTTGTTGGTTTTCCGATGTAGTTAGTTAACAT
CTGCTATTTTTGCGCAGGTTTTAGCAC

hnrnpaba TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hnrnpaba-201 (1)    Ensembl 825
hnrnpaba-202 (1)    Ensembl 4413
hnrnpaba-204 (1)    Ensembl 689
hnrnpaba-205 (1)    Ensembl 765
hnrnpaba-206 (1)    Ensembl 1285
ncRNA hnrnpaba-003 787
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hnrnpaba-003 Contained in:
[Fosmid] CH1073-115D16 (1), ZFOS-1809E12 (1)

Genome Resources: Vega_Trans:OTTDART00000049449 (1),  Ensembl_Trans:ENSDART00000148497 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CV111539 (1) 795 nt
CITATIONS (2)