ZFIN ID: ZDB-TSCRIPT-110325-1425
Transcript Name: hnrnpaba-204
Previous Names: hnrnpab-002, hnrnpaba-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049448 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049448|OTTDARG00000034843|ZDB-GENE-030131-185 hnrnpaba|OTTDARP00000038785 hnrnpab-002 LG_none FQ377590.3,CU658205.6 Danio rerio protein_coding KNOWN, 689 bp
AATATAAAACCAACCGCTTGTCGGCGCAATAAGGAAGGGC
CCACACCGCGGAAAGCGTTCCACGGAGACTTTTCACTTGC
TGCTGTTACGGTTTTCACATTCAACTACCACCATGTCAGA
CGCCGAGCAGCAGTATATGGAAACCTCACTGAACGGCCAC
GAGGGTGAGGATGATTTGAACGGAGCCGGGCAGTACGATC
AGGGCAACGGGGATGCGCAGGCCGGGGCGCAAGGAAACGC
CGGTGCGGACGGGACGGCCGGAGACGATGGAGCGGACGGC
GGGCAAATTGATGCGAGCAAAGGAGAGGAAGATGCGGGGA
AAATGTTCGTCGGGGGCCTCAGCTGGGACACCAGTAAAAA
GGATCTTAAAGATTATTTCTCTAAATTTGGAGAGGTGACA
GACTGCACCATTAAAATGGACCCAAACACTGGACGTTCAA
GGGGATTCGGGTTCATTCTTTTCAAAGAGCCATCAGGTGT
AGATAAGGTTTTAGCACAAAAGGAGCACAGACTGGATGGA
CGACAGATTGACCCCAAGAAGGCAATGGCAATGAAAAAGG
AGCCAGTTAAGAAGATCTTTGTTGGCGGACTGAACCCTGA
AACCACAGAAGAGAGGATCCGCGAGTATTTCGGTGCCTTT
GGCGAGATTGAGACTATCGAGCTTCCAATGGACCCCAAGT
CAAACAAGA

hnrnpaba TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hnrnpaba-201 (1)    Ensembl 825
hnrnpaba-202 (1)    Ensembl 4413
hnrnpaba-204 689
hnrnpaba-205 (1)    Ensembl 765
hnrnpaba-206 (1)    Ensembl 1285
ncRNA hnrnpaba-003 (1)    Ensembl 787
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hnrnpaba-204 Contained in:
[Fosmid] CH1073-115D16 (1), ZFOS-1809E12 (1)

Genome Resources: Vega_Trans:OTTDART00000049448 (1),  Ensembl_Trans:ENSDART00000149114 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:FP125396 (1) 683 nt
GenBank:CD282248 (1) 490 nt
CITATIONS (2)