ZFIN ID: ZDB-TSCRIPT-110325-2334
Transcript Name: hnrnpaba-201
Previous Names: hnrnpab-005, hnrnpaba-005

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049452 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049452|OTTDARG00000034843|ZDB-GENE-030131-185 hnrnpaba|OTTDARP00000038788 hnrnpab-005 LG_none FQ377590.3,CU658205.6 Danio rerio protein_coding KNOWN, 825 bp
TTACGGTAAGGTTTTAAACAGAAAATAACGATTTTTGGCA
CTTTTAGTGCACATATTTCGTCGTGTTAACGTTTACATCT
AATCTCACGCAACTAAACGTTTTTAGGTTTTCACATTCAA
CTACCACCATGTCAGACGCCGAGCAGCAGTATATGGAAAC
CTCACTGAACGGCCACGAGGGTGAGGATGATTTGAACGGA
GCCGGGCAGTACGATCAGGGCAACGGGGATGCGCAGGCCG
GGGCGCAAGGAAACGCCGGTGCGGACGGGACGGCCGGAGA
CGATGGAGCGGACGGCGGGCAAATTGATGCGAGCAAAGGA
GAGGAAGATGCGGGGAAAATGTTCGTCGGGGGCCTCAGCT
GGGACACCAGTAAAAAGGATCTTAAAGATTATTTCTCTAA
ATTTGGAGAGGTGACAGACTGCACCATTAAAATGGACCCA
AACACTGGACGTTCAAGGGGATTCGGGTTCATTCTTTTCA
AAGAGCCATCAGGTGTAGATAAGGTTTTAGCACAAAAGGA
GCACAGACTGGATGGACGACAGATTGACCCCAAGAAGGCA
ATGGCAATGAAAAAGGAGCCAGTTAAGAAGATCTTTGTTG
GCGGACTGAACCCTGAAACCACAGAAGAGAGGATCCGCGA
GTATTTCGGTGCCTTTGGCGAGATTGAGACTATCGAGCTT
CCAATGGACCCCAAGTCAAACAAGAGGAGAGGCTTTGTCT
TCATTACCTTCAAGGAAGAAGAGGCGGTCAAGAAGATTCT
GGAGAAGAAATATCACAATGTCAGTGGAACCAAGGACACA
AGCGGAAAAGAAGGCCTTGTGAGTT

hnrnpaba TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hnrnpaba-201 825
hnrnpaba-202 (1)    Ensembl 4413
hnrnpaba-204 (1)    Ensembl 689
hnrnpaba-205 (1)    Ensembl 765
hnrnpaba-206 (1)    Ensembl 1285
ncRNA hnrnpaba-003 (1)    Ensembl 787
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hnrnpaba-201 Contained in:
[Fosmid] CH1073-115D16 (1), ZFOS-1809E12 (1)

Genome Resources: Vega_Trans:OTTDART00000049452 (1),  Ensembl_Trans:ENSDART00000148394 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH996596 (1) 910 nt
GenBank:CA974998 (1) 899 nt
GenBank:CD753893 (1) 842 nt
GenBank:CD752106 (1) 819 nt
CITATIONS (2)