Transcript

atp6ap2-203

ID
ZDB-TSCRIPT-110325-444
Name
atp6ap2-203
Previous Names
  • atp6ap2-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049210 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049210|OTTDARG00000009490|ZDB-GENE-040426-1960 atp6ap2|OTTDARP00000038615 atp6ap2-003 LG_ BX649485.4 Danio rerio protein_coding KNOWN, 658 bp
AATCGATTCAAGAACGTGCCTAGTAACCCTGGAAGCCCCT
ACAACCTGGCCTACAAGTACAACTTTGACTACGCTGTGAT
CTTCAACATCGTCCTGTGGCTAATGATCGTGTTAGCATTA
GCCGTCATCGCTATCTCCTACAACCTCTGGAACATGGATC
CGGGATACGATAGCATCATCTACAGGATGACCAATCAGAA
GATCCGACTGGACTGAAGAAGTCCGTCACATTCCATTCCA
TTTGTGTGTGTGTGTTTAAATGTGTGTGTGTGTTTTTTTT
TTTTGATGTCATTGTACAAATGCTTTGTCTTTAAGACTCA
ATCAAACACAGAGATACAGATTATTTATTGTTGGAGAATC
CTAATCGTTGTATGGTGTGAATCTACTGAAGTGGATGTAA
AGAGTTCAGATTTAACATATTTATTATTGTTTGTCGTTCA
CTTGATTGTGCTCTTTACCGTCCTGAAGACTGGATGTAGT
GTAATTACACCATTCCTGTGTACATTAGCTCTGAATTGCT
GTCATTTTCATTGAGTAGAGCTAGAAAGTGGGAAATGAGA
CATTTAAGGTATGATGTTTTGTTGTGTATAGATGTTGTTC
ATGCTTATTGTGTACAAATGCAAGTGTAACTCAAATAATA
AAACAAAATTCCATCACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations