Transcript

atp6ap2-201

ID
ZDB-TSCRIPT-110325-1352
Name
atp6ap2-201
Previous Names
  • atp6ap2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049211 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049211|OTTDARG00000009490|ZDB-GENE-040426-1960 atp6ap2|OTTDARP00000038616 atp6ap2-002 LG_ BX649485.4 Danio rerio protein_coding KNOWN, 841 bp
TTATGAACGCCGTATTTGCCCTTATAGGACTCTTATCAGT
TTGACAGTTTTGCGAAGCCCTCAGTATGTGACTTTTCGGG
ATGAGCAGTGGCCCATATCGGGTGAAAAGATCCCAGATTT
AGTTGCTCTGACCATGGGCTTCTCTGTTCGTGAGGATCTC
GATTGGCCAGGTCTGGCTGCCGGTTCACTGTTCCAGCGTC
CTCGTGCTAACGCTCTAATCGTTGTGCGTGGCATCGACAG
CCTGGACTTTCCAAAAAACGTGTCCTCTTACCCTCTCGAA
AATCCGGTTCCGTTCACTCTGGACAGTGTGGCGAATACAA
TTCACACGCTGTTTGCTGACAGCACGCCTGTGGTCTTACA
GCTCGCACCCAGTGAAGAGAGGCTGTATATGATGGGAATG
GCCAACACAGTTTTTGAGGATCTTCCTGTCACTCTGCAGC
AGATTCGTGGACGTCTGTCTCAGGACGGATCCGTTCTCAC
GTCCCTTCCTCTCGTCTCTCTCAGCCGCAACAATGAGGCT
GATCTTCTGTTCCTCTCTGAGGTTCAGGTGCTGTATGACA
TCTCAGCTCTGTTGCAGAAACACAAGCATCTGGCTAAAGA
TCCTGCTCCTGATCTTTACTCTCTGGAGCTGGCGGGACTG
GAGGAGATTGTTCGCCGCTACGGCACAGACTCACCTCAGT
ACACCGACGCCATTAGGATCCTTACAATTGCTCTGCAGAA
GTTTGCAGATGACGTCTCCAGTGTTTACGGAAACAATGCG
GTTGTAGAAGTCGTGACCGTGAAGACTTTTGAAGTCCCTC
TGACCAGAAAATCACGCTCCATCCTCGAGTCCAAGCAAAT
G

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations