Transcript

atp6ap2-202

ID
ZDB-TSCRIPT-090929-1844
Name
atp6ap2-202
Previous Names
  • atp6ap2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000010885 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000010885|OTTDARG00000009490|ZDB-GENE-040426-1960 atp6ap2|OTTDARP00000009369 atp6ap2-001 LG_ BX649485.4 Danio rerio protein_coding KNOWN, 1619 bp
GCAGACTGAGGGAAATGTTGTTGCGTCATGACGCACGACG
TCACGCGGCTGGCCCTGGTCATGTGACTGGTGTTGCGAGG
AAGCGCAGTCCATCAGAAAATCGTCCCGAGATGAATCGAA
TAATTATGAACGCCGTATTTGCCCTTATAGGACTCTTATC
AGGTGTTTTGGGGGACAGTTTGACAGTTTTGCGAAGCCCT
CAGTATGTGACTTTTCGGGATGAGCAGTGGCCCATATCGG
GTGAAAAGATCCCAGATTTAGTTGCTCTGACCATGGGCTT
CTCTGTTCGTGAGGATCTCGATTGGCCAGGTCTGGCTGCC
GGTTCACTGTTCCAGCGTCCTCGTGCTAACGCTCTAATCG
TTGTGCGTGGCATCGACAGCCTGGACTTTCCAAAAAACGT
GTCCTCTTACCCTCTCGAAAATCCGGTTCCGTTCACTCTG
GACAGTGTGGCGAATACAATTCACACGCTGTTTGCTGACA
GCACGCCTGTGGTCTTACAGCTCGCACCCAGTGAAGAGAG
GCTGTATATGATGGGAATGGCCAACACAGTTTTTGAGGAT
CTTCCTGTCACTCTGCAGCAGATTCGTGGACGTCTGTCTC
AGGACGGATCCGTTCTCACGTCCCTTCCTCTCGTCTCTCT
CAGCCGCAACAATGAGGCTGATCTTCTGTTCCTCTCTGAG
GTTCAGGTGCTGTATGACATCTCAGCTCTGTTGCAGAAAC
ACAAGCATCTGGCTAAAGATCCTGCTCCTGATCTTTACTC
TCTGGAGCTGGCGGGACTGGAGGAGATTGTTCGCCGCTAC
GGCACAGACTCACCTCAGTACACCGACGCCATTAGGATCC
TTACAATTGCTCTGCAGAAGTTTGCAGATGACGTCTCCAG
TGTTTACGGAAACAATGCGGTTGTAGAAGTCGTGACCGTG
AAGACTTTTGAAGTCCCTCTGACCAGAAAATCACGCTCCA
TCCTCGAGTCCAAGCAAATGAGTAACCCTGGAAGCCCCTA
CAACCTGGCCTACAAGTACAACTTTGACTACGCTGTGATC
TTCAACATCGTCCTGTGGCTAATGATCGTGTTAGCATTAG
CCGTCATCGCTATCTCCTACAACCTCTGGAACATGGATCC
GGGATACGATAGCATCATCTACAGGATGACCAATCAGAAG
ATCCGACTGGACTGAAGAAGTCCGTCACATTCCATTCCAT
TTGTGTGTGTGTGTTTAAATGTGTGTGTGTGTTTTTTTTT
TTTGATGTCATTGTACAAATGCTTTGTCTTTAAGACTCAA
TCAAACACAGAGATACAGATTATTTATTGTTGGAGAATCC
TAATCGTTGTATGGTGTGAATCTACTGAAGTGGATGTAAA
GAGTTCAGATTTAACATATTTATTATTGTTTGTCGTTCAC
TTGATTGTGCTCTTTACCGTCCTGAAGACTGGATGTAGTG
TAATTACACCATTCCTGTGTACATTAGCTCTGAATTGCTG
TCATTTTCATTGAGTAGAGCTAGAAAGTGGGAAATGAGAC
ATTTAAGGTATGATGTTTTGTTGTGTATAGATGTTGTTCA
TGCTTATTGTGTACAAATGCAAGTGTAACTCAAATAATAA
AACAAAATTCCATCACTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations