Transcript

trpm7-003

ID
ZDB-TSCRIPT-110325-414
Name
trpm7-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049115 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049115|OTTDARG00000034671|ZDB-GENE-021115-2 trpm7|no_translation trpm7-003 LG_ CU928201.7 Danio rerio protein_coding KNOWN, 514 bp
CCAGAGTTCTGGATGTCCTGTGTGTGTTCTCCGCAGTGCT
GACCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCG
CACGCTCCTGCAGGGTAACATGCGGACGGTGAACTCTTAC
GCCGGCTTCACAGAGTTGGACAGAAACCCTTCGCTCCTGC
ATCCAGAGTCCACACTCAGTAAGCAGGAGAGGACGCGCGT
GTCGCTGGAGGACGTCTCTCGATATGAGGATCTGCTGCTG
GGGAAGTCCGCTCAGTCCAGCAAGCTGAGTCCAGGAGACG
ACGCCTCTAACACAGGTCTGTACGCTGGTCGTCACACACA
CCTGGGTGCGCGTAAGGACTCGATCGGTTCTCCATTCAAG
CCCATGGAGAGTTATCAGTACTCGGCGGTGGAGCGTAATA
ACCTGATGCGGTTGTCTCAGAGCATCCCCTTCACCCCGGT
GCCCCCTAGAGGTGAGCCGGTGAGTGTGTATCGTCTGGAG
GAGAGCTCCCCCGGCAGTATCAATAACAGCATGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations