Transcript

trpm7-203

ID
ZDB-TSCRIPT-110325-2229
Name
trpm7-203
Previous Names
  • trpm7-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049114 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049114|OTTDARG00000034671|ZDB-GENE-021115-2 trpm7|OTTDARP00000038541 trpm7-002 LG_ CU928201.7 Danio rerio protein_coding KNOWN, 625 bp
GGTTGAGGCTGTGCAGGGGGCGGGGCTTCCTCATGCTTCA
CTCACTGCAGACGGTGTGCAGACACCGCAGATGCGCCGCC
GCGGACACCAGGAACATCTCTCCAGCGCTCCGGCTGCCGC
CGCCAGCTTCTTCCTCAGCACGCCGCTGCCGCAGCAGCAG
GACCTGCAGGCGCCGCCGGAGGAGTTCGGGGCGTTCGTGG
GTGAGTGTGAGGAGTGTGTGTGTGTGAGTGTGCCGAGCGA
CGCAGGCGTGCCGCTGCTGGTCGTCAGTGAGGCCGAGTGT
GAGGGATTCGTCAATCTGGGCTTCAGTGCGGATGAAGAGC
CGTCTGACACACACACACCGCTCCCTTCTCTCCGGCCCCC
GAGGAGCTGCTGCAGAAGCCCGCACACAGCCCGAGGTCAC
AAGGATGAGCCTGAGGGTCAAAGGTCAATCCCTAAGGAGA
GCGCTGTCAGCAGTCCATCCAGAAAGACCCGCGATGTGGG
TAACATGCGGACGGTGAACTCTTACGCCGGCTTCACAGAG
TTGGACAGAAACCCTTCGCTCCTGCATCCAGAGTCCACAC
TCAGTAAGCAGGAGAGGACGCGCGTGTCGCTGGAGGACGT
CTCTCGATATGAGGATCTGCTGCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations