Transcript

trpm7-201

ID
ZDB-TSCRIPT-110325-1321
Name
trpm7-201
Previous Names
  • trpm7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049113 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049113|OTTDARG00000034671|ZDB-GENE-021115-2 trpm7|OTTDARP00000038540 trpm7-001 LG_ CU928201.7 Danio rerio protein_coding KNOWN, 2499 bp
GGTGGAGACGATGTGTGTGCAGCTGAAGGAGGTTGGAAAT
AAGGTGAACTTCATCAAGCGCTCTCTGCACACGCTGGACT
CTCAGATCGGGCACCTGCAGGATCTGTCTGCGCTGACGGT
GGACACCCTGAAGGCTCTGACGGCCCAGCGCGCATCTGAA
GCCAGCAAAGTGCACAACCAGATCACACGTGAGCTTAGCG
TGTCCCGAAACCTGGCGCCCGAGGCCGTGCCGCCGTCCAA
ACCCGGCGCTCTGGTGCGCTGCAGCGTGGCCTTCATGCCG
CCCAATAGCATGGCGGACTCTCTGTTTGGGGGCGGGGTTG
AGGCTGTGCAGGGGGCGGGGCTTCCTCATGCTTCACTCAC
TGCAGACGGTGTGCAGACACCGCAGATGCGCCGCCGCGGA
CACCAGGAACATCTCTCCAGCGCTCCGGCTGCCGCCGCCA
GCTTCTTCCTCAGCACGCCGCTGCCGCAGCAGCAGGACCT
GCAGGCGCCGCCGGAGGAGTTCGGGGCGTTCGTGGGTCAC
AAGGATGAGCCTGAGGGTCAAAGGTCAATCCCTAAGGAGA
GCGCTGTCAGCAGTCCATCCAGAAAGACCCGCGATGTGGG
TAACATGCGGACGGTGAACTCTTACGCCGGCTTCACAGAG
TTGGACAGAAACCCTTCGCTCCTGCATCCAGAGTCCACAC
TCAGTAAGCAGGAGAGGACGCGCGTGTCGCTGGAGGACGT
CTCTCGATATGAGGATCTGCTGCTGGGGAAGTCCGCTCAG
TCCAGCAAGCTGAGTCCAGGAGACGACGCCTCTAACACAG
GTCTGTACGCTGGTCGTCACACACACCTGGGTGCGCGTAA
GGACTCGATCGGTTCTCCATTCAAGCCCATGGAGAGTTAT
CAGTACTCGGCGGTGGAGCGTAATAACCTGATGCGGTTGT
CTCAGAGCATCCCCTTCACCCCGGTGCCCCCTAGAGGTGA
GCCGGTGAGTGTGTATCGTCTGGAGGAGAGCTCCCCCGGC
AGTATCAATAACAGCATGTCGTCGTGGGCTCAGCGCGGGC
TCTGTGCGAAGATCGAGTTCCTCAGTAAGGAGGAGATGGG
CGGGGGGCTGCGGCGCGCGCTCAAGGTGCTCTGCACGTGG
TCCGAGTACGACATCCTGAAGCCCGGACACCTGTACATCG
TCAAGTCCTTCCTGCCCGAGGTGGTCAACACCTGGCAGAC
CATCTACAGGGAGGAGACGGTGCTGCACCTCTGCCTCAGG
GAAATTCAGCAGCAGAGAGCAGCTCAGAAACTCACGTTTG
CCTTCAATCAGATCCGACCCAAAACCATCCCGTACTCGCC
CAGGTTCCTGGAGGTCTTCCTGCTGTACTGTCATTCTGCC
GGTCAGTGGTTCGCCATCGAGGAGTGCATCACTGGAGATT
TCCGCAAGTTTAACAACAACAACGGAGATGAAATAGTGCC
GACCAACCTTCTGGAGGAAACCATGCTGGCCTTCAGCCAC
TGGACGTATGAATACACACGAGGAGAGCTGCTGGTGCTGG
ACCTGCAGGGTGTGGGTGAGATTCTGACCGATCCGTCGGT
CATCAAGAGCGGAGAGAAAGGGTCTTACGATATGATCTTT
GGACCTGCAAACCTCGGAGACGACGCCATTCGAAACTTCC
GTGCCAAACATCACTGCAACTCCTGCTGCCGAAAACTCAA
ACTTCCAGATCTGAAACGGAACGACTACACTCCTGATAAG
CTGACCCTTCAGCATGACCCCTCCGAGGGCCCGTCCCACT
CTCCGCCTGCAGGGGCCGCCACTAAAGAACTGCGTCCCTC
CATGCGCTTAATGCTGTGAGCCGCGCACACACACACCTGC
AGGACTCGCACTGTGCCGCCGAGAATCACGTGATGACAAA
CACAAAGTGCACGTTTGCGTGTTTGGTGTGTGCGTGTTTT
ATACAAGAATGCGTCGCCTCTGAACAAATGAAATTTAATA
AGTCACATTTTATCCTGTACATTTCATGACAGGGATTATC
AGCTTTTAAAAGTATTTTTTTTAAACATTTCTATGTCTGT
ATGAAATTATAAAGTGGTTAATAACTGGTACAATATCACT
GTATAAAGTCAAATATTTATTCTAAACGACAAGTTGCCTT
GTATAAAAGAAGAGCAATTTTACGTGATGTCTGTCACCTT
TTTGCAGAGGACACTTGCTCATTATATATCTATTATCAGA
TTTTGTACAGAGCTGTATGCCAACAGAATGTTTTTATGTA
CAGAGAGCCACGTGTGGAGAGCTGTATCAATGCATTTATG
TTTGAATCTTGTTTAGATTATGGGCAGATTGCAATGCAAA
CGACAGCGCAGTGTGTGTGATTTCATTGTGCTGACCACTG
AAACCGGGCCACACCATCACAACTCAACTTTATAATGTTA
CAGCGGTACTTTTGTCATTCGTTGTCGTTGGAGAATCGTG
CGAGACTGTTAATCTAGTGTATCTCATAGATACATGTATC
TGGCACGGTTCTGTCAGCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations