Transcript

gtf2f2a-205

ID
ZDB-TSCRIPT-110325-226
Name
gtf2f2a-205
Previous Names
  • gtf2f2a-005
  • dkey-151m22.4-005
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048327 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048327|OTTDARG00000021885|ZDB-GENE-040625-131 gtf2f2a|OTTDARP00000037920 DKEY-151M22.4-005 LG_ CR339054.14 Danio rerio protein_coding KNOWN, 1139 bp
TGGTTTGAGTTTGTGTGCGCGTTTGCTTCCGCTAACTGCT
ACAATGAGGTTTGGCGTGCCATGATTACTTTGGCATGTTT
TCCCCCTCGTTCTTATGTTGCCATCCCTCTCATAGGGCAG
TCAGATGCTGAGGCCAGCGGCTCAGGTACTGGTTCAGGCC
CAGGTGAGTGCCCCCTGCTGGAGTGGAGGTCCGGGAAAGA
CCAAATCAAGCATTTTTAATGGCCTTTGATTTGACAATCA
GCCAACAAAACAGCAATTATTCATAATTCCTAATTCCTAA
TTTTAATGATTGGTGAACAGTTTAATACTTGCACAGAACA
TGCTGTTGTGCCTCTCGCTGCCGCTTATGTAATGATGGGC
AGCGTTACAGCAGCGATTATGTGGCTATAACTGTCATTGA
GTAATAATGTCTCTGTTCTCTCACAAAGATAAAATCGCAC
TGGAAGGAGTAGTGGTGCAGAGAGCGGAATGCAGACCGGC
CGTCAGTGAAAGCTACATGAGGCTTAAGAAACTGCAGATT
GAGGAATTATCGAAACCCCTCAGGTTTTCTCAGCAGCTGG
ACAAAGCAGTTACCACTAACTACAAACCAGTGGCTAATCA
TGCTTATAATCTCGACTATGAGAAGAGGAAGAAAGAAGAA
GGGAAGAGGGCACGTGCAGATAAACAGCAGGTGCTGGACA
TGTTGTTCTCCGCTTTTGAGAAGCATCAGTTTTATAACAT
TAAGGATCTGGTGGACATCACAAAACAGCCTGTGATTTAC
TTGAAGGAGATTCTTCGGGACATTGGCATTTACAATGTCA
AAGGCACCCACAAAAACACCTGGGAGCTCAAACCCGAGTA
CAGGCATTACCAGAGCGAAGAGAAGAGTGACTGATCCTCT
TCAAGATCACCTGCTTACATGTGTTTGGACTCAGAATGAC
TGAAATGTTATTTCTGGATTATTTCAAGGATTCTTCTGTT
GTTTTTAGAGCTGCATCTGAAACTCATGTTATGTTTTACA
ACGCTAAGATGTTTTATTGAGAAATGGAATTGTTCAATCA
GAACTGAGGGAAAACACGCATTATATAGCAGCAATTGGTG
TATAACGAGAAGGTGATGTCAGAATTTTAAGTAAAAGTTA
AGTAAAATATTCTGATTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations