Transcript

gtf2f2a-003

ID
ZDB-TSCRIPT-090929-10552
Name
gtf2f2a-003
Previous Names
  • gtf2f2-003
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028019 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028019|OTTDARG00000021885|ZDB-GENE-040625-131 gtf2f2a|no_translation DKEY-151M22.4-003 LG_ CR339054.14 Danio rerio protein_coding KNOWN, 721 bp
AACGGGGGCGAAACAGAACGCTGGTGTATGGCTGGTTAAA
GTCCCAAAGTACTTGTCACAGCAATGGACCAAAGCAACAG
GGAGAGGAGAAGTTGGAAAGCTCCGAATTAGCAAGAATCA
AGGAAAGGCAGAGGTGTCATTCACACTCAATGAGGAGCTG
ACCACAATAGAGACTATTGGAGAGAAGACCTCTATGGTAC
GAGCCCCTAGAGAGCATCCTTTCACTTTGCAGACAGTTGG
TGGACAAACTCTGGCTGTTTTTACTGAAAACTCTTCAGAT
AAAATCGCACTGGAAGGAGTAGTGGTGCAGAGAGCGGAAT
GCAGACCGGCCGTCAGTGAAAGCTACATGAGGCTTAAGAA
ACTGCAGATTGAGGAATTATCGAAACCCCTCAGGTTTTCT
CAGCAGCTGGACAAAGCAGTTACCACTAACTACAAACCAG
TGGCTAATCATGCTTATAATGTAGGTCAATATGATTTATG
TTGTAAAACGGGCGTCCTGTGTATTTTTTATGCAGAACAC
TTTGTTTGTTGGTTTTTCCAAAGCTCGACTATGAGAAGAG
GAAGAAAGAAGAAGGGAAGAGGGCACGTGCAGATAAACAG
CAGGTGCTGGACATGTTGTTCTCCGCTTTTGAGAAGCATC
AGTTTTATAACATTAAGGATCTGGTGGACATCACAAAACA
GCCTGTGATTTACTTGAAGGAGATTCTTCGGGACATTGGC
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations