Transcript

gtf2f2a-201

ID
ZDB-TSCRIPT-090929-10551
Name
gtf2f2a-201
Previous Names
  • gtf2f2-002
  • gtf2f2a-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028018 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028018|OTTDARG00000021885|ZDB-GENE-040625-131 gtf2f2a|OTTDARP00000022927 DKEY-151M22.4-002 LG_ CR339054.14 Danio rerio protein_coding KNOWN, 1072 bp
GTTCTGTTGTTGATACTGCAGCGCTAGCTAACGTGTGTTG
CGTGGAGGAGGTACATTAAATACACATGAAACAAGTCTAA
TAAAAACACATTTTAACGTTACAGTATTAACAGGCATGTC
GGAGAAAGGAGAGGTAGATTTAACGGGGGCGAAACAGAAC
GCTGGTGTATGGCTGGTTAAAGTCCCAAAGTACTTGTCAC
AGCAATGGACCAAAGCAACAGGGAGAGGAGAAGTTGGAAA
GCTCCGAATTAGCAAGAATCAAGGAAAGGCAGAGGTGTCA
TTCACACTCAATGAGGAGCTGACCACAATAGAGACTATTG
GAGAGAAGACCTCTATGGTACGAGCCCCTAGAGAGCATCC
TTTCACTTTGCAGACAGTTGGTGGACAAACTCTGGCTGTT
TTTACTGAAAACTCTTCAGATAAAATCGCACTGGAAGGAG
TAGTGGTGCAGAGAGCGGAATGCAGACCGGCCGTCAGTGA
AAGCTACATGAGGCTTAAGAAACTGCAGATTGAGGAATTA
TCGAAACCCCTCAGGTTTTCTCAGCAGCTGGACAAAGCAG
TTACCACTAACTACAAACCAGTGGCTAATCATGCTTATAA
TCTCGACTATGAGAAGAGGAAGAAAGAAGAAGGGAAGAGG
GCACGTGCAGATAAACAGCAGGTGCTGGACATGTTGTTCT
CCGCTTTTGAGAAGCATCAGTTTTATAACATTAAGGATCT
GGTGGACATCACAAAACAGCCTGTGATTTACTTGAAGGAG
ATTCTTCGGGACATTGGCATTTACAATGTCAAAGGCACCC
ACAAAAACACCTGGGAGCTCAAACCCGAGTACAGGCATTA
CCAGAGCGAAGAGAAGAGTGACTGATCCTCTTCAAGATCA
CCTGCTTACATGTGTTTGGACTCAGAATGACTGAAATGTT
ATTTCTGGATTATTTCAAGGATTCTTCTGTTGTTTTTAGA
GCTGCATCTGAAACTCATGTTATGTTTTACAACGCTAAGA
TGTTTTATTGAGAAATGGAATTGTTCAATCAGAACTGAGG
GAAAACACGCATTATATAGCAGCAATTGGTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations