ZFIN ID: ZDB-TSCRIPT-110325-1966
Transcript Name: bves-202
Previous Names: bves-002, popdc1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048032 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048032|OTTDARG00000034042|ZDB-GENE-040624-11 bves|OTTDARP00000037693 popdc1-002 LG_ BX511173.7 Danio rerio protein_coding KNOWN, 1798 bp
AATGCGCTCCTCACACACACACTCCGGCTCTCAGCTCTGC
TAAACCTATCTCTTATCTTCTGCATTAACATTCCTCCAGA
CCGAGCACATTAAAGCTGCTTTCGACAACACCGCTTGACC
GCCTCAGAATGTCCAACACAACATCCGCGCTGCCCTCCAG
TGTTCCAGCTGTCAGCTTGGATCCAAACGCCACACTATGC
CAGGATTGGGAACAGTCTCATCACCTGCTGTTCCACCTGG
CCAACCTGAGTCTCGGGCTGGGTTTCCTCATTCCCACCAC
ATTAGCGCTTCATATGATCTTCCTCAGGCTGCTGCTGATG
ACAGGCTGCTCTTTGTTCATAGCGTGGGCTACGTTATATA
GATGCACACTGGATGTTATGGTGTGGAATGTGGTTTTCCT
TCTAGTGAACTTCATGCATTTCTTCTTCCTGCTTTATAAA
CGCAGACCGATTAAGATTGACAGGGAGCTCAAGTCAGTGT
ACAAGCGCATGTTCGAGCCCCTGCATGTGCGAGAGGCTCT
GTTTCAGAGACTCACTGGCCAGTTTTGCACTATCCAGACA
TTAAAGAAAGGCCAGGTTTATGCAGCAGAAGACAAAACCT
CTGTTGACGAGCGCCTCAGCATTCTTCTCAAAGGAAAGAT
GAAGGTATCGTATCGGGGTCATTTCTTGCATAACATTTAC
ACCAATGCCTTCATCGACTCTCCAGAATTCAGGTCAACTC
AGATGAACAGGGGTGAACGCTTTCAGGTGACGATCGCTGC
TGAGGAGAACTGCAAGCTGTTGTGCTGGTCCAGAGAACGT
CTGACTTATTTCCTGGAGTCAGAGTCTTTTCTGAATGAGG
TCTTCAGGTATCTCATTGGCAAAGACATCACCAACAAGCT
TTACTCCCTCAACGATCCAACCCTCAGTGACAAGGCTGTA
AAGAAAATGGACCGCCAGCCGAGTCTGTGTTCCCAGCTGT
CTATGATGCAGATGAGGAACAGCATGGCGAGCACCAGTGA
CACTGACGACGTGCTCAATCAGATCCTGAGAGGTGGATCA
ACTGGCTCATCACTTCCTGTGACCTCAGATCGGGCCTGAT
GGGGTAGAAAAATCCTCTGACGAAAACATCCACGACTATG
AAGCCAATCGAAGAAGGACTGGAAGATGATGTTTTTGAAT
CCGAGTCCCCCACCACCTCCCAGAATGTTTCAAAGACCAC
CAAAAAAGACATTTAAACGTATTTGATCACCTCGCAGTCT
TAGCCTTTAGCATTTCACTGCTCATTCGACAGAAACGAAT
GTGAGATTACACTAGTATAAGTTAAGAGACCCCTTAGGCA
GGCAGATTTATCCTTGAAAATATTTTCGGATATCATATGA
TCGACTGTAGTATTTTCTTGCTTCACATAACAAACAGTTT
GATTTTTCCATCATTTCTCTAATGATCAAGTAGAAATATA
GCTTATGCTTCCTTGCATGCTCCTGATTTCTCAAGTCCTA
TTTTCACATGTGATTATGTTCCAGTGTTCTATTATGCGGA
TTACACCATTTGTGCCTTTGATTTGATCACATAATGTTAC
TAAGGAATCACTTAGTTTAAGCAATGTGTGTTACATTTGA
ATTTACTGAATGTCCTATTTAAAGCATTTTGATCTCTTGT
AAGTAGTTTATTTTATTCTGTGATTATAAGGATGAGACGT
TTGTGTGTTTAAAATCATACAGATACTTGAAATCACTTTT
TAAATTAAAGTTTTGCATCATGCTGTCTTCGTGCCAACCT
GGGTGTTTTCATAAAAACAAAGAACATTTATGATGCAA

bves TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA bves-201 (1) 1771
bves-202 1798
bves-203 (1) 1827
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bves-202 Contained in:
OTHER bves-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048032 (1)
  • Ensembl_Trans:ENSDART00000081422 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY293118 (1) 1856bp
    GenBank:CO920091 (1) 827bp
    GenBank:DT878576 (1) 750bp
    GenBank:CB363918 (1) 576bp
    CITATIONS (2)