Transcript

bves-201

ID
ZDB-TSCRIPT-110325-150
Name
bves-201
Previous Names
  • bves-003
  • popdc1-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048030 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048030|OTTDARG00000034042|ZDB-GENE-040624-11 bves|OTTDARP00000037691 popdc1-003 LG_ BX511173.7 Danio rerio protein_coding KNOWN, 1771 bp
GGAATGCGCTCCTCACACACACACTCCGGCTCTCAGCTCT
GCTAAACCTATCTCTTATCTTCTGCATTAACATTCCTCCA
GACCGAGCACATTAAAGCTGCTTTCGACAACACCGCTTGA
CCGCCTCAGAATGTCCAACACAACATCCGCGCTGCCCTCC
AGTGTTCCAGCTGTCAGCTTGGATCCAAACGCCACACTAT
GCCAGGATTGGGAACAGTCTCATCACCTGCTGTTCCACCT
GGCCAACCTGAGTCTCGGGCTGGGTTTCCTCATTCCCACC
ACATTAGCGCTTCATATGATCTTCCTCAGGCTGCTGCTGA
TGACAGGCTGCTCTTTGTTCATAGCGTGGGCTACGTTATA
TAGATGCACACTGGATGTTATGGTGTGGAATGTGGTTTTC
CTTCTAGTGAACTTCATGCATTTCTTCTTCCTGCTTTATA
AACGCAGACCGATTAAGATTGACAGGGAGCTCAAGTCAGT
GTACAAGCGCATGTTCGAGCCCCTGCATGTGCGAGAGGCT
CTGTTTCAGAGACTCACTGGCCAGTTTTGCACTATCCAGA
CATTAAAGAAAGGCCAGGTTTATGCAGCAGAAGACAAAAC
CTCTGTTGACGAGCGCCTCAGCATTCTTCTCAAAGGAAAG
ATGAAGGTATCGTATCGGGGTCATTTCTTGCATAACATTT
ACACCAATGCCTTCATCGACTCTCCAGAATTCAGGTCAAC
TCAGATGAACAGGGGTGAACGCTTTCAGGTGACGATCGCT
GCTGAGGAGAACTGCAAGCTGTTGTGCTGGTCCAGAGAAC
GTCTGACTTATTTCCTGGAGTCAGAGTCTTTTCTGAATGA
GGTCTTCAGGTATCTCATTGGCAAAGACATCACCAACAAG
CTTTACTCCCTCAACGATCCAACCCTCAGTGACAAGGCTG
TAAAGAAAATGGACCGCCAGCCGAGTCTGTGTTCCCAGCT
GTCTATGATGCAGATGAGGAACAGCATGGCGAGCACCAGT
GACACTGACGACGTGCTCAATCAGATCCTGAGAGGTGGAT
CAACTGGCTCATCACTTCAGAAAAATCCTCTGACGAAAAC
ATCCACGACTATGAAGCCAATCGAAGAAGGACTGGAAGAT
GATGTTTTTGAATCCGAGTCCCCCACCACCTCCCAGAATG
TTTCAAAGACCACCAAAAAAGACATTTAAACGTATTTGAT
CACCTCGCAGTCTTAGCCTTTAGCATTTCACTGCTCATTC
GACAGAAACGAATGTGAGATTACACTAGTATAAGTTAAGA
GACCCCTTAGGCAGGCAGATTTATCCTTGAAAATATTTTC
GGATATCATATGATCGACTGTAGTATTTTCTTGCTTCACA
TAACAAACAGTTTGATTTTTCCATCATTTCTCTAATGATC
AAGTAGAAATATAGCTTATGCTTCCTTGCATGCTCCTGAT
TTCTCAAGTCCTATTTTCACATGTGATTATGTTCCAGTGT
TCTATTATGCGGATTACACCATTTGTGCCTTTGATTTGAT
CACATAATGTTACTAAGGAATCACTTAGTTTAAGCAATGT
GTGTTACATTTGAATTTACTGAATGTCCTATTTAAAGCAT
TTTGATCTCTTGTAAGTAGTTTATTTTATTCTGTGATTAT
AAGGATGAGACGTTTGTGTGTTTAAAATCATACAGATACT
TGAAATCACTTTTTAAATTAAAGTTTTGCATCATGCTGTC
TTCGTGCCAACCTGGGTGTTTTCATAAAAACAAAGAACAT
TTATGATGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations