Transcript

bves-203

ID
ZDB-TSCRIPT-110325-1058
Name
bves-203
Previous Names
  • bves-001
  • popdc1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048031 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048031|OTTDARG00000034042|ZDB-GENE-040624-11 bves|OTTDARP00000037692 popdc1-001 LG_ BX511173.7 Danio rerio protein_coding KNOWN, 1827 bp
GGAATGCGCTCCTCACACACACACTCCGGCTCTCAGCTCT
GCTAAACCTATCTCTTATCTTCTGCATTAACATTCCTCCA
GACCGAGCACATTAAAGCTGCTTTCGACAACACCGCAAAC
TCTCTGGCCATTTCCCAAACAGCTTGACCGCCTCAGAATG
TCCAACACAACATCCGCGCTGCCCTCCAGTGTTCCAGCTG
TCAGCTTGGATCCAAACGCCACACTATGCCAGGATTGGGA
ACAGTCTCATCACCTGCTGTTCCACCTGGCCAACCTGAGT
CTCGGGCTGGGTTTCCTCATTCCCACCACATTAGCGCTTC
ATATGATCTTCCTCAGGCTGCTGCTGATGACAGGCTGCTC
TTTGTTCATAGCGTGGGCTACGTTATATAGATGCACACTG
GATGTTATGGTGTGGAATGTGGTTTTCCTTCTAGTGAACT
TCATGCATTTCTTCTTCCTGCTTTATAAACGCAGACCGAT
TAAGATTGACAGGGAGCTCAAGTCAGTGTACAAGCGCATG
TTCGAGCCCCTGCATGTGCGAGAGGCTCTGTTTCAGAGAC
TCACTGGCCAGTTTTGCACTATCCAGACATTAAAGAAAGG
CCAGGTTTATGCAGCAGAAGACAAAACCTCTGTTGACGAG
CGCCTCAGCATTCTTCTCAAAGGAAAGATGAAGGTATCGT
ATCGGGGTCATTTCTTGCATAACATTTACACCAATGCCTT
CATCGACTCTCCAGAATTCAGGTCAACTCAGATGAACAGG
GGTGAACGCTTTCAGGTGACGATCGCTGCTGAGGAGAACT
GCAAGCTGTTGTGCTGGTCCAGAGAACGTCTGACTTATTT
CCTGGAGTCAGAGTCTTTTCTGAATGAGGTCTTCAGGTAT
CTCATTGGCAAAGACATCACCAACAAGCTTTACTCCCTCA
ACGATCCAACCCTCAGTGACAAGGCTGTAAAGAAAATGGA
CCGCCAGCCGAGTCTGTGTTCCCAGCTGTCTATGATGCAG
ATGAGGAACAGCATGGCGAGCACCAGTGACACTGACGACG
TGCTCAATCAGATCCTGAGAGGTGGATCAACTGGCTCATC
ACTTCCTGTGACCTCAGATCGGGCCTGATGGGGTAGAAAA
ATCCTCTGACGAAAACATCCACGACTATGAAGCCAATCGA
AGAAGGACTGGAAGATGATGTTTTTGAATCCGAGTCCCCC
ACCACCTCCCAGAATGTTTCAAAGACCACCAAAAAAGACA
TTTAAACGTATTTGATCACCTCGCAGTCTTAGCCTTTAGC
ATTTCACTGCTCATTCGACAGAAACGAATGTGAGATTACA
CTAGTATAAGTTAAGAGACCCCTTAGGCAGGCAGATTTAT
CCTTGAAAATATTTTCGGATATCATATGATCGACTGTAGT
ATTTTCTTGCTTCACATAACAAACAGTTTGATTTTTCCAT
CATTTCTCTAATGATCAAGTAGAAATATAGCTTATGCTTC
CTTGCATGCTCCTGATTTCTCAAGTCCTATTTTCACATGT
GATTATGTTCCAGTGTTCTATTATGCGGATTACACCATTT
GTGCCTTTGATTTGATCACATAATGTTACTAAGGAATCAC
TTAGTTTAAGCAATGTGTGTTACATTTGAATTTACTGAAT
GTCCTATTTAAAGCATTTTGATCTCTTGTAAGTAGTTTAT
TTTATTCTGTGATTATAAGGATGAGACGTTTGTGTGTTTA
AAATCATACAGATACTTGAAATCACTTTTTAAATTAAAGT
TTTGCATCATGCTGTCTTCGTGCCAACCTGGGTGTTTTCA
TAAAAACAAAGAACATTTATGATGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations