ZFIN ID: ZDB-TSCRIPT-110325-1058
Transcript Name: bves-203
Previous Names: bves-001, popdc1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048031 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048031|OTTDARG00000034042|ZDB-GENE-040624-11 bves|OTTDARP00000037692 popdc1-001 LG_ BX511173.7 Danio rerio protein_coding KNOWN, 1827 bp
GGAATGCGCTCCTCACACACACACTCCGGCTCTCAGCTCT
GCTAAACCTATCTCTTATCTTCTGCATTAACATTCCTCCA
GACCGAGCACATTAAAGCTGCTTTCGACAACACCGCAAAC
TCTCTGGCCATTTCCCAAACAGCTTGACCGCCTCAGAATG
TCCAACACAACATCCGCGCTGCCCTCCAGTGTTCCAGCTG
TCAGCTTGGATCCAAACGCCACACTATGCCAGGATTGGGA
ACAGTCTCATCACCTGCTGTTCCACCTGGCCAACCTGAGT
CTCGGGCTGGGTTTCCTCATTCCCACCACATTAGCGCTTC
ATATGATCTTCCTCAGGCTGCTGCTGATGACAGGCTGCTC
TTTGTTCATAGCGTGGGCTACGTTATATAGATGCACACTG
GATGTTATGGTGTGGAATGTGGTTTTCCTTCTAGTGAACT
TCATGCATTTCTTCTTCCTGCTTTATAAACGCAGACCGAT
TAAGATTGACAGGGAGCTCAAGTCAGTGTACAAGCGCATG
TTCGAGCCCCTGCATGTGCGAGAGGCTCTGTTTCAGAGAC
TCACTGGCCAGTTTTGCACTATCCAGACATTAAAGAAAGG
CCAGGTTTATGCAGCAGAAGACAAAACCTCTGTTGACGAG
CGCCTCAGCATTCTTCTCAAAGGAAAGATGAAGGTATCGT
ATCGGGGTCATTTCTTGCATAACATTTACACCAATGCCTT
CATCGACTCTCCAGAATTCAGGTCAACTCAGATGAACAGG
GGTGAACGCTTTCAGGTGACGATCGCTGCTGAGGAGAACT
GCAAGCTGTTGTGCTGGTCCAGAGAACGTCTGACTTATTT
CCTGGAGTCAGAGTCTTTTCTGAATGAGGTCTTCAGGTAT
CTCATTGGCAAAGACATCACCAACAAGCTTTACTCCCTCA
ACGATCCAACCCTCAGTGACAAGGCTGTAAAGAAAATGGA
CCGCCAGCCGAGTCTGTGTTCCCAGCTGTCTATGATGCAG
ATGAGGAACAGCATGGCGAGCACCAGTGACACTGACGACG
TGCTCAATCAGATCCTGAGAGGTGGATCAACTGGCTCATC
ACTTCCTGTGACCTCAGATCGGGCCTGATGGGGTAGAAAA
ATCCTCTGACGAAAACATCCACGACTATGAAGCCAATCGA
AGAAGGACTGGAAGATGATGTTTTTGAATCCGAGTCCCCC
ACCACCTCCCAGAATGTTTCAAAGACCACCAAAAAAGACA
TTTAAACGTATTTGATCACCTCGCAGTCTTAGCCTTTAGC
ATTTCACTGCTCATTCGACAGAAACGAATGTGAGATTACA
CTAGTATAAGTTAAGAGACCCCTTAGGCAGGCAGATTTAT
CCTTGAAAATATTTTCGGATATCATATGATCGACTGTAGT
ATTTTCTTGCTTCACATAACAAACAGTTTGATTTTTCCAT
CATTTCTCTAATGATCAAGTAGAAATATAGCTTATGCTTC
CTTGCATGCTCCTGATTTCTCAAGTCCTATTTTCACATGT
GATTATGTTCCAGTGTTCTATTATGCGGATTACACCATTT
GTGCCTTTGATTTGATCACATAATGTTACTAAGGAATCAC
TTAGTTTAAGCAATGTGTGTTACATTTGAATTTACTGAAT
GTCCTATTTAAAGCATTTTGATCTCTTGTAAGTAGTTTAT
TTTATTCTGTGATTATAAGGATGAGACGTTTGTGTGTTTA
AAATCATACAGATACTTGAAATCACTTTTTAAATTAAAGT
TTTGCATCATGCTGTCTTCGTGCCAACCTGGGTGTTTTCA
TAAAAACAAAGAACATTTATGATGCAA

bves TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA bves-201 (1) 1771
bves-202 (1) 1798
bves-203 1827
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bves-203 Contained in:
OTHER bves-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048031 (1)
  • Ensembl_Trans:ENSDART00000149404 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY293117 (1) 1883bp
    GenBank:CN512856 (1) 611bp
    GenBank:CB360128 (1) 455bp
    CITATIONS (2)