ZFIN ID: ZDB-TSCRIPT-110325-1535
Transcript Name: zgc:113411-003
Previous Name: dkey-68o6.1-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049913 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049913|OTTDARG00000021664|ZDB-GENE-050417-474 zgc:113411|no_translation DKEY-68O6.1-003 LG_ BX569789.4 Danio rerio protein_coding KNOWN, 994 bp
AGATGTGTGTGATGTGTTCAATAGTGAGAAACTCATCCAC
TTCCCGCTCTTCAAAAAATGCAGATAATACAGCGGCCTCA
TTCATGAAATGACTCTTCAGCCCTTTCTGGAATCTGCTCG
ACTCCGTGAGAACAGCAGAAACAACAATCACAACCAACCG
GGTGAAGAAGGATGAAGAAAAAAAGCTGCAAGAAATCACG
CCAGATCAGGTCGTCCTCCATCTGCAGCTCCAAGAGAAAG
AAACAAGCTAAAAGCAAAAACTGCCTCCAATCGTCTTCAA
GTCAATCCCGACTTCCTGTTACGTGTGGATATAAAGAGGG
GTTACTGGATTTGAAGAAATATTATAAAAGGCAAAAGTGC
ATCTTAAGTGAAGACCGCTGGTTTACGCCCACTGAGTTTG
AGAGGTTTGGGAGAAAGGAGAAAAACAAAAAGTGGAGGAC
CAGCATCCTTTGCAAAGGGATTACACTCCAGAAACTCATA
GAGGTGCAAAAGTCCGGTTTTAATATACTTTTAGTACATA
AGAAACACACTAAAGTGCATTTTAAAAAGTGCATGTTCAT
TTGGAAACAATATTTTTATGACACTTTTTTTTATTTCTTT
GTCTTTCCTAATTTGAGTTTTCTCTCTACAGGATGGATTT
CTTTTACCTAAAACCTTTATGAAAGGCAGGATTCATGGTG
AAAAGCAGAAGAAAAGGCCAGAGGTTTTGCAGCAGCAGGT
GTTAGAATCAGCTGAGAAGAGTAATGGCAGTCAAGGAGAG
GATGACGATGATATTGACATGACCAAGTTCGAAGGTGCGA
CATTACCTGTGGCCTGCGGTTCAAACTCTGGTGTCCTACA
CAAGTGCCGCTTTGCTGGAGAGCGTTGTGGGAGATGCATA
AGAACAGAGAACTCCTGGTTGACGCCTGAGGGTTTCATCA
AATTGAACAAGCCAGATGGAATATGGAGGAAAGACATTGT
TTCCAATGGAGTTCCTCTCGGAAGACTTATAAAG

sp100.4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:113411-201 (1)    Ensembl 1810
zgc:113411-202 (1)    Ensembl 477
ncRNA zgc:113411-003 994
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:113411-003 Contained in:
[BAC] DKEY-68O6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000049913 (1),  Ensembl_Trans:ENSDART00000148414 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH454532 (1) 1047 nt
CITATIONS (2)