ZFIN ID: ZDB-TSCRIPT-090929-10192
Transcript Name: zgc:113411-202
Previous Name: zgc:113411-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027645 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027645|OTTDARG00000021664|ZDB-GENE-050417-474 zgc:113411|OTTDARP00000022642 DKEY-68O6.1-002 LG_ BX569789.4 Danio rerio protein_coding KNOWN, 477 bp
ACTGACGTGTCTGTCTTTTACCCGTTTATTAAAGACTGCA
AATGGATCTCTCGACAAGTTCTGAGTCATCATTACAACTG
AAGTCTTTTGACACAATCTATTATATTACAATTACATTGC
ATTACAATGTATTGAACACACGTCTAACACTTACTGCCTA
TCTTCACTCTTATCAAAATTATATCTGTGGCACTAGCTTA
ACTAAGGTCTGTAGACTGTAGAAATGAATTGTAAACTGGG
ACTGTCGTACGTTATCTGTGACAGCAATTTAACTGTAATA
TCACGTTGAGATAATACAGCGGCCTCATTCATGAAATGAC
TCTTCAGCCCTTTCTGGAATCTGCTCGACTCCGTGAGAAC
AGCAGAAACAACAATCACAACCAACCGGGTGAAGAAGGAT
GAAGAAAAAAAGCTGCAAGAAATCACGCCAGATCAGGTCG
TCCTCCATCTGCAGCTCCAAGAGAAAGAAACAAGCTA

sp100.4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:113411-201 (1)    Ensembl 1810
zgc:113411-202 477
ncRNA zgc:113411-003 (1)    Ensembl 994
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:113411-202 Contained in:
[BAC] DKEY-68O6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000027645 (1),  Ensembl_Trans:ENSDART00000123994 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK697559 (1) 479 nt
CITATIONS (2)